ORFeome > polr2g ORF1 – XORFeome v1.0

polr2g ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: polr2g
Gene ID: 1006757
Gene Page ID: 1006750
ORF Xenbase ID: 17289927

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128968
Original XGC clone length: 519

Human orthology & disease relationships

NCBI Entrez ID: 5436
Ensembl gene IDs: ENSG00000168002
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,151623,154500,162210,164300,193520,204000,214150,214450,216400,253300,253400,253550,256710,268000,277700,278300,278780,300590,303600,600334,601675,601777,602875,603689,604145,607136,608807,608808,609065,609227

Library Location

Plate ID: GDExl11092
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ838942
dbEST ID: 79656644
Trimmed Sequence: ATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGATCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTT
Full Trace Sequence: TCGGGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGATCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGCCAACCAGCTTAAAACCCCTATAGTGAGTCGTATTACATGGTCATAGCTGGTTTCAAGAAAAAAAAAAAACAAAAAATAAAAACCATAAAAATTTAAAAAAANACCCAAAAAAACCCGAAAATGAAAAAAATCCCTGACTGGGCCCTGGGTGGGTTTGGTATGTCAGTAGGTAGAAGAAAACAGCTAAAAATCAGCCCCTGGAACCGCTTCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTTACCATATCTCACTGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838941
dbEST ID: 79656643
Trimmed Sequence: GCTCACCAGACCAAGATAATCATCCATCAGAGAGCCAATTGCAAAAATGTCATTTTTATCCACTCTTGTCCCAACGATTTTGAGCCGGATCTCATCATCCTGTTGAATGACAACATCCTCGTCCACTGTCTTATAACATGGTGGGTTAGAATTTGGGTCAAATTCCATTTCCGATGGGATTGAGTGTCTCGATATGAAGCAGGACATAGGACCGATTTCAGTGAATAATCCAACCTTATTAACCTGGGTCACCACAGCATCGATCACCTCACCCTTGAAAGGACGGAAGACAATGGCCTTGTACTTGACAGGATACAGCACAAACCCTCTGCCTGGCTGGATCACCCCGGCCCCAATGTTATCGATTGTGGTTACTGCGATCACAAAACCATACTTGCCAGTACATGTTCCCTCTACCTCANTGAAGAGTTTCTGTTTGACAGTGTTGAGAAGGTTAGGGCCAAAATATCTTGGGTGCAGAAGAATTTCATGTTCCAGTGAGATATGGTATAACATGG
Full Trace Sequence: CGGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTCACCAGACCAAGATAATCATCCATCAGAGAGCCAATTGCAAAAATGTCATTTTTATCCACTCTTGTCCCAACGATTTTGAGCCGGATCTCATCATCCTGTTGAATGACAACATCCTCGTCCACTGTCTTATAACATGGTGGGTTAGAATTTGGGTCAAATTCCATTTCCGATGGGATTGAGTGTCTCGATATGAAGCAGGACATAGGACCGATTTCAGTGAATAATCCAACCTTATTAACCTGGGTCACCACAGCATCGATCACCTCACCCTTGAAAGGACGGAAGACAATGGCCTTGTACTTGACAGGATACAGCACAAACCCTCTGCCTGGCTGGATCACCCCGGCCCCAATGTTATCGATTGTGGTTACTGCGATCACAAAACCATACTTGCCAGTACATGTTCCCTCTACCTCANTGAAGAGTTTCTGTTTGACAGTGTTGAGAAGGTTAGGGCCAAAATATCTTGGGTGCAGAAGAATTTCATGTTCCAGTGAGATATGGTATAACATGGTGCCAACTTTTTTGTACAAAATTGGCATTATAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTAATCAATCAAATAAAATCATTATTTTGAAAAAAGAACAAAAAAAAAAAAAGAAAATAAAAAAACAAAAGAACTGGGCAAAAAAAAAGGNNGGTGCGGTACAGGANGAAAGGGGGGTTTGGGGTGTGGGAGGGGGGAGGGGGAGGGGGGGGGGNGGGGGAGGGAGGAAAAGGGGNGGGGNNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCACCAGACCAAGATAA