ORFeome > polr2k ORF1 – XORFeome v1.0

polr2k ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: polr2k
Gene ID: 6254323
Gene Page ID: 854168
ORF Xenbase ID: 17289951

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078622
Original XGC clone length: 177

Human orthology & disease relationships

NCBI Entrez ID: 5440
Ensembl gene IDs: ENSG00000147669
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,151623,162210,164300,193520,204000,214150,214450,216400,256710,268000,277700,278300,278780,300590,303600,601675,601777,602875,607136,609065,609227

Library Location

Plate ID: GDExl11005
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ839834
dbEST ID: 79657536
Trimmed Sequence: ATGGAAGGCCAAAAGGACGCGCCTCCTCCTAAGCAGCAGCCGATGATATACATTTGTGGAGAATGCCACACGGAAAATGAAATAAAAGCAAGAGATCCAATCAGGTGCAGAGAATGTGGTTACAGAATAATGTACAAGAAAAGAACAAAACGATTGGTTGTGTTTGATGCTCGCTT
Full Trace Sequence: CTCGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGGCCAAAAGGACGCGCCTCCTCCTAAGCAGCAGCCGATGATATACATTTGTGGAGAATGCCACACGGAAAATGAAATAAAAGCAAGAGATCCAATCAGGTGCAGAGAATGTGGTTACAGAATAATGTACAAGAAAAGAACAAAACGATTGGTTGTGTTTGATGCTCGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAAAAAAAAACAAAAAAAAAATTTAATTGAATTTGGGAAAATGCGGGGGCATGAGAACAACAAGATCATCCTGGACAAAGGGGCGGGGGGGGTTCTGCTGTTTTTGGTTGGGGGGGTGGAGCCAAACGGGAAAAAACGGGAGGGGGGGGTGAGGCGAGTGGAAAAAAGCGGGGGCGGGCCGGCCGGCGGAAAAGCAAGTAACAGAAGGCGGGGGGGGGGGGGGGCGGGGGCCTTTGACCGAATTGTATGGGTTTTTTGGGTGGTGTGGGGCTTTTTTCCGGGCCGCGACCGAACGGGTTTTTGGGGGGGGGGTGTGTGTGTTTTGGGGAAACAAAAAAAAAAAGCCCGGTGGACGCGGCGGGGGTCAATTATTTATTATTTATAAGGGGGAGAGGGAGGAGATAAACTAACAAACAGGAAGCAAAATCCTCGTGAAAAACAGTGCTCTCCCACCCCTCCATTGCAGGGGCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGGCCAAAAGGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839833
dbEST ID: 79657535
Trimmed Sequence: GCGAGCATCAAACACAACCAATCGTTTTGTTCTTTTCTTGTACATTATTCTGTAACCACATTCTCTGCACCTGATTGGATCTCTTGCTTTTATTTCATTTTCCGTGTGGCATTCTCCACAAATGTATATCATCGGCTGCTGCTTAAGAGGAGGCGCGTCCTTTTGGCCTTCCATGG
Full Trace Sequence: AAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGAGCATCAAACACAACCAATCGTTTTGTTCTTTTCTTGTACATTATTCTGTAACCACATTCTCTGCACCTGATTGGATCTCTTGCTTTTATTTCATTTTCCGTGTGGCATTCTCCACAAATGTATATCATCGGCTGCTGCTTAAGAGGAGGCGCGTCCTTTTGGCCTTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAACCTTAATACTGGCCGTCGTTAAAAAAAAAAAAAAAAAAAAAATAACCACAGATACCGGGAAGACCGGGCGGCAAAAGAAAAAAAATCTCGGGCACAAAGGGGGGCGTGGGTGTTCCTTCGGTGGGTGGGGAGGAGACCCAACACGGGGAAAAACAGGGGGCGGCTTTCTAATTAAGTAAAAAAGGGGCGGGCCGCGCCCTGGAGCGGAAAAAAGATAGAAACCAAGGGGGGGGGGCCGGGAGCGTTTTTTTTATTGTTTTGTTAATATTTTTTTTTGGGAATTTTCTCCCCCCGAGCCCACACCANACTCCTCCGCCCCGGCCCGGGGGTCGTTGGGGAGGAAAAAAACAAAGNTAGAAATNACCNGAGGGGGCCGGGNTNNAGAAAGAAAAGAGAAANAAAAGAGGGGGGGGGGGGGGGGGGGGAAACACCCCACCNNAAAAGAAGNGNNGGGGGGGGNGGGGGGGNNGGGGCGCGNNNGGNNGNGNGGGGTGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGAGCATCAAACACAACCA