ORFeome > polr2l.1 ORF1 – XORFeome v1.0

polr2l.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: polr2l.1
Gene ID: 6255885
Gene Page ID: 1003787
ORF Xenbase ID: 17289963

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097791
Original XGC clone length: 204

Human orthology & disease relationships

NCBI Entrez ID: 5441
Ensembl gene IDs: ENSG00000177700
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,151623,154500,162210,164300,193520,204000,214150,214450,216400,253300,253400,253550,256710,268000,277700,278300,278780,300590,303600,600334,601675,601777,602875,603689,604145,607136,608807,608808,609065,609227

Library Location

Plate ID: GDExl11089
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ838349
dbEST ID: 79656051
Trimmed Sequence: ATGATCATCCCAGTCCGGTGCTTTACATGTGGGAAGATTGTAGGAAATAAATGGGAGGCTTACCTTGGCCTTTTACAGGCTGAATATACAGAAGGAGATGCGCTCGATGCCTTGGGCCTAAAAAGATACTGTTGCCGCCGGATGCTCCTGGCTCATGTCGACTTGATTGAGAAACTGTTAAACTACGCCCCTTTGGAGAAATT
Full Trace Sequence: GGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCATCCCAGTCCGGTGCTTTACATGTGGGAAGATTGTAGGAAATAAATGGGAGGCTTACCTTGGCCTTTTACAGGCTGAATATACAGAAGGAGATGCGCTCGATGCCTTGGGCCTAAAAAGATACTGTTGCCGCCGGATGCTCCTGGCTCATGTCGACTTGATTGAGAAACTGTTAAACTACGCCCCTTTGGAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCATAAAAACAGGAAAGAAGTAATCCTCATGACTGCGCTAGACCAGCCTCGACTGAGATGAATCGACCTCGCTGCTACACCGGGTTGTCGGGTGACGTACTCTTTGGCAACGGATGATGGCACGAGCACCATGAACATAGCGTGTTCGATTCGTACGCTGTAATGCAATGCCCTAAGGCCGCCCGGCACCGGTCCCGAACCTTGAACGAACGCCGAGGTCGGTAACGGGGAAATGGGCGGGTTACCTGGGATTGGTAGGACTGTTTTTTGTGGGGGACCGTCCAGGCCTCCTGTCCCCCGGGCAGGAACCGCGGTTACTCCCTGGGGTCGATTGTTTTAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCATCCCAGTCCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838348
dbEST ID: 79656050
Trimmed Sequence: TTTCTCCAAAGGGGCGTAGTTTAACAGTTTCTCAATCAAGTCGACATGAGCCAGGAGCATCCGGCGGCAACAGTATCTTTTTAGGCCCAAGGCATCGAGCGCATCTCCTTCTGTATATTCAGCCTGTAAAAGGCCAAGGTAAGCCTCCCATTTATTTCCTACAATCTTCCCACATGTAAAGCACCGGACTGGGATGATCATGG
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAATTTCTCCAAAGGGGCGTAGTTTAACAGTTTCTCAATCAAGTCGACATGAGCCAGGAGCATCCGGCGGCAACAGTATCTTTTTAGGCCCAAGGCATCGAGCGCATCTCCTTCTGTATATTCAGCCTGTAAAAGGCCAAGGTAAGCCTCCCATTTATTTCCTACAATCTTCCCACATGTAAAGCACCGGACTGGGATGATCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGGCCGTCGAATTAAAACAAGATAACTGAACCCTAAAGGAACGGATGGCCCAGCAACGATAAAACGAAAGGACCTTCCTGAGAACGGGGCCTTGCGGTTGACATGCGCTTTGGCGAGGAAAGAGGGCTCAACACAATAAAATGAAGGGGGTGGGTTAAAGGGTGGAATGCAGGAGAAGAAGGGCGGCCGCACTGGGAAAAAAGCCTAGAAAAAAGCCACGGGGGGAAGGGGGGAAGGGGGGTTTTCAGGTGGTGAGTAAGACGGTTTGTGGGGGTAAAAGGAAGGGCGAGGGAGAACCAGGGGGCAGGCGGGGACTGCAAGGTGGGGAATGGTTAGTTTAGGAAGAAAAAGAAGAGAGTCACAGAACAAAGCGGAGGGTGGAGGGAAAGNA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTCCAAAGGGGCGTAGT