ORFeome > pomc ORF1 – XORFeome v1.0

pomc ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pomc
Gene ID: 483707
Gene Page ID: 483702
ORF Xenbase ID: 17289999

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054160
Original XGC clone length: 780

Human orthology & disease relationships

NCBI Entrez ID: 5443
Ensembl gene IDs: ENSG00000115138
Directly associated (OMIM) disease MIM numbers: 601665,609734
Indirectly associated (Lage, et al.) disease MIM numbers: 182290,202200,601665,603278,607841

Library Location

Plate ID: GDExl11001
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ839206
dbEST ID: 79656908
Trimmed Sequence: ATGTTTCGGCCACTTTGGGGCTGTTTCCTTGCAATACTCGGAATATGTATATTCCATATCGGAGAGGTCCAAAGCCAGTGCTGGGAGAGCAGCCGATGTGCAGACCTCAGCAGTGAAGATGGTGTTCTGGAATGCATCAAGGCATGTAAAACGGATCTCTCTGCCGAATCACCTGTGTTCCCAGGAAACGGACATTTGCAACCTTTGTCGGAAAGTATCAGAAAATATGTGATGACCCATTTTCGGTGGAATAAATTTGGCAGAAGAAACAGCACAGGGAACGATGGAAGCAACACAGGCTACAAACGTGAAGATATTTCCAGTTACCCTGTATTTAGCCTATTTCCCTTAAGTGATCAGAATGCTCCAGGTGACAACATGGAAGAGGAACCCTTAGACAGGCAAGAGAACAAGAGAGCCTACTCTATGGAGCACTTCCGATGGGGAAGGACCTGTTGGGAGAGAGAGGAGGCCCATTAAGGTGTACCCCAATGGAGTGGAAGAGGAGTCTGCTGAGAGCGACACCATGGAGTTGAGAAGAGAATGATCCCCACAACTTGACTATCCCCCAAACCACCTTGATGAAGGAATTTAAAAACAATGAAGATGGAGAGGTGATGAGGCGAAAAAAAAATGGGGAAATTGAGGGATTGCATTAGGTTTGGCTTGGTGTGGGGGGGGCGGCCCCCCCACAGAAAGTGAGGGGAGGGGGGGGGTGTATTAATGAGGACAGGGAGGCCCGCAACAAAATTCTTTTTCGGTGTTGTCTTTGTAGCAGAAAACGTCTCCCAGAAGACAACACCCCCGGAGTGGAGAAGAGGGGGGGGGGGGG
Full Trace Sequence: TGTGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCGGCCACTTTGGGGCTGTTTCCTTGCAATACTCGGAATATGTATATTCCATATCGGAGAGGTCCAAAGCCAGTGCTGGGAGAGCAGCCGATGTGCAGACCTCAGCAGTGAAGATGGTGTTCTGGAATGCATCAAGGCATGTAAAACGGATCTCTCTGCCGAATCACCTGTGTTCCCAGGAAACGGACATTTGCAACCTTTGTCGGAAAGTATCAGAAAATATGTGATGACCCATTTTCGGTGGAATAAATTTGGCAGAAGAAACAGCACAGGGAACGATGGAAGCAACACAGGCTACAAACGTGAAGATATTTCCAGTTACCCTGTATTTAGCCTATTTCCCTTAAGTGATCAGAATGCTCCAGGTGACAACATGGAAGAGGAACCCTTAGACAGGCAAGAGAACAAGAGAGCCTACTCTATGGAGCACTTCCGATGGGGAAGGACCTGTTGGGAGAGAGAGGAGGCCCATTAAGGTGTACCCCAATGGAGTGGAAGAGGAGTCTGCTGAGAGCGACACCATGGAGTTGAGAAGAGAATGATCCCCACAACTTGACTATCCCCCAAACCACCTTGATGAAGGAATTTAAAAACAATGAAGATGGAGAGGTGATGAGGCGAAAAAAAAATGGGGAAATTGAGGGATTGCATTAGGTTTGGCTTGGTGTGGGGGGGGCGGCCCCCCCACAGAAAGTGAGGGGAGGGGGGGGGTGTATTAATGAGGACAGGGAGGCCCGCAACAAAATTCTTTTTCGGTGTTGTCTTTGTAGCAGAAAACGTCTCCCAGAAGACAACACCCCCGGAGTGGAGAAGAGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCGGCCACTTTGGGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839205
dbEST ID: 79656907
Trimmed Sequence: CTGACCCTTTTTGTGGGAGTTTTTAATGATGGCATTTTTGAAAAGAGTCATTAGAGGTGTCTGGCTCCGCTCAGGAGTCATAAATCCCCCATACCTCTTATCTTTGGGTGGACTACCCCAGCGAAAGTGATGCATCCTATAATTCCCATTTTTTTTCGTTAATGCACTCTCCACCTCATTGTCTTCAATGTCCTCATCAAGGTCGATTTCTGGATAGTCAAGTTCTAGGGATAATTCTCTTCTCAACTCCATGGGGTAGCTCTCAGCAGACTCTTCTTCCACTCCATTGGGGTACACCTTAATGGGCCTCCTCTTTCTCCCAACAGGTTTTCCCCATCGGAAGTGCTCCATAGAGTAGGCTCTCTTGTTCTCTTGCCTGTCTAAGGGTTCCTCTTCCATGTTGTCACCTGGAGCATTCTGATCACTTAAGGGAAATAGGCTAAATACAGGGTAACTGGAAATATCTTCACGTTTGTAGCCTGTGTTGCTTCCATCGTTCCCTGTGCTGTTTCTTCTGCCAAATTTATTCCACCGAAAATGGGTCATCACATATTTTCTGATACTTTCCCGACAAGGTTTGCAAATGTCCCGTTTCCTGGGAACACCAGGGGATTCCGGCGAAGAGAATCCGTTTTAAATGCCTTGATGCATTTCCAAACACCATCCTTCCCTGCCTAAAGGTCTGCACCATCCGCCGGTCCTTCCCAACACTGGGCTTTTGGAACCCCCCCCAAATTGGGAAATTTACATTATTTCCCCAAGTTATTTGGAAG
Full Trace Sequence: ACGGGAATTCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGACCCTTTTTGTGGGAGTTTTTAATGATGGCATTTTTGAAAAGAGTCATTAGAGGTGTCTGGCTCCGCTCAGGAGTCATAAATCCCCCATACCTCTTATCTTTGGGTGGACTACCCCAGCGAAAGTGATGCATCCTATAATTCCCATTTTTTTTCGTTAATGCACTCTCCACCTCATTGTCTTCAATGTCCTCATCAAGGTCGATTTCTGGATAGTCAAGTTCTAGGGATAATTCTCTTCTCAACTCCATGGGGTAGCTCTCAGCAGACTCTTCTTCCACTCCATTGGGGTACACCTTAATGGGCCTCCTCTTTCTCCCAACAGGTTTTCCCCATCGGAAGTGCTCCATAGAGTAGGCTCTCTTGTTCTCTTGCCTGTCTAAGGGTTCCTCTTCCATGTTGTCACCTGGAGCATTCTGATCACTTAAGGGAAATAGGCTAAATACAGGGTAACTGGAAATATCTTCACGTTTGTAGCCTGTGTTGCTTCCATCGTTCCCTGTGCTGTTTCTTCTGCCAAATTTATTCCACCGAAAATGGGTCATCACATATTTTCTGATACTTTCCCGACAAGGTTTGCAAATGTCCCGTTTCCTGGGAACACCAGGGGATTCCGGCGAAGAGAATCCGTTTTAAATGCCTTGATGCATTTCCAAACACCATCCTTCCCTGCCTAAAGGTCTGCACCATCCGCCGGTCCTTCCCAACACTGGGCTTTTGGAACCCCCCCCAAATTGGGAAATTTACATTATTTCCCCAAGTTATTTGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGACCCTTTTTGTGGGA