ORFeome > pop7 ORF1 – XORFeome v1.0

pop7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pop7
Gene ID: 6253257
Gene Page ID: 6456901
ORF Xenbase ID: 17290029

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128905
Original XGC clone length: 384

Human orthology & disease relationships

NCBI Entrez ID: 10248
Ensembl gene IDs: ENSG00000172336
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 215600,253300,253400,253550,600334,603689,604145,604219,606595,608807,608808

Library Location

Plate ID: GDExl11086
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ837886
dbEST ID: 79655588
Trimmed Sequence: ATGGCGGAACAAAAACCACTTCCTGGGCGGGTCCATCACACGCGTCGTCCAGCCCCCCGGCCGCCTCGCAGCCCAAATGACATCTACGTGACTACAAAGACTGATTTCCGGGCTCAGTTGGCTCGGTGCCGGCAACTTCTCAGTACCGGAGACTTTAGGGAACTGAGGGTCCATGGTTTGGGCCTGGCCATTGGACGTGCCATTAACTTGGCTCTGCAGCTGCAGTTGTCCTACCCCGGGACTCTGCACATCTCCCCCAACACCTCCACCGTAGAACTGACCGATGATCTGGAATCTGAGGGCGGAGAGGACATGGAACCTGGAGCCCGGAACCGCAATAACTCCGCCATTCATATCCGCGTGTATCGCCCGCAGGGAGAGTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACAAAAACCACTTCCTGGGCGGGTCCATCACACGCGTCGTCCAGCCCCCCGGCCGCCTCGCAGCCCAAATGACATCTACGTGACTACAAAGACTGATTTCCGGGCTCAGTTGGCTCGGTGCCGGCAACTTCTCAGTACCGGAGACTTTAGGGAACTGAGGGTCCATGGTTTGGGCCTGGCCATTGGACGTGCCATTAACTTGGCTCTGCAGCTGCAGTTGTCCTACCCCGGGACTCTGCACATCTCCCCCAACACCTCCACCGTAGAACTGACCGATGATCTGGAATCTGAGGGCGGAGAGGACATGGAACCTGGAGCCCGGAACCGCAATAACTCCGCCATTCATATCCGCGTGTATCGCCCGCAGGGAGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGGTCATAGCTGTTTCCTGGGNGCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAATACACTACCTGCCCCACGCCCGGGGGAGAAAAAAAAAAAACCAACCCCCCCCCCACCCAGAGGGGAAAAAGTGTGTTTTTGTTTATGAGGAGAAGGAGGAGCGGCCCCCCAAAAACAAAAAACCCGGGGGGGGGGAAGGGTGTGGGTGTGTTTTTTGTATGCAGGAGAAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACAAAAACCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837885
dbEST ID: 79655587
Trimmed Sequence: CTCTCCCTGCGGGCGATACACGCGGATATGAATGGCGGAGTTATTGCGGTTCCGGGCTCCAGGTTCCATGTCCTCTCCGCCCTCAGATTCCAGATCATCGGTCAGTTCTACGGTGGAGGTGTTGGGGGAGATGTGCNNAGTCCCGGGGTAGGACAACTGCAGCTGCCCAGCCNAGTTAATGGCACGTCCAATGGCCAGGCCCAAACCATGGACCCTCAGTTCCCTAAAGTCTCCGGTACTGAGAAGTTGCCGGCACCGAACCAACTGAGCCCGGAGATCAGTCTTTGTAGTCACATAAATGTCATTTGGGCTGCGAGGCGGCCGGGGGGCTGGACGACNCGTGTGATGGACCCCCCCAGGAAGTGGTTGTTGTTCCCCCGTGG
Full Trace Sequence: GGGGCGGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTCCCTGCGGGCGATACACGCGGATATGAATGGCGGAGTTATTGCGGTTCCGGGCTCCAGGTTCCATGTCCTCTCCGCCCTCAGATTCCAGATCATCGGTCAGTTCTACGGTGGAGGTGTTGGGGGAGATGTGCNNAGTCCCGGGGTAGGACAACTGCAGCTGCCCAGCCNAGTTAATGGCACGTCCAATGGCCAGGCCCAAACCATGGACCCTCAGTTCCCTAAAGTCTCCGGTACTGAGAAGTTGCCGGCACCGAACCAACTGAGCCCGGAGATCAGTCTTTGTAGTCACATAAATGTCATTTGGGCTGCGAGGCGGCCGGGGGGCTGGACGACNCGTGTGATGGACCCCCCCAGGAAGTGGTTGTTGTTCCCCCGTGGTGCCAACTTTTTTGTACAAANTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGGCAACGAGCAGGTGACTATCANTCGAAAGTAAATCATTAATTGGNGGCCGAGCTTANNNANNNAAAAAAAAAAAAAAAAATCAAAACAAAAAAAAGCGCCCCCGCCCCCGGGCGGGCCGGAAANNAAANNNNGNGAAGAAAAAAAAACCGGGGGTGGATGTTTTGCTGGTGGGTGGGGAGGAGACGGGCGACAAAAAAAAACAACACGGGCCGGCGCGAAAAGGGGGGGGGGTGTATAATTGCGGGGGGGAGGGGGGAGAACCCCCTCCCCACGGANAGAAAGGGCCGGCGGGGGGGGGGGGGGTTTGGGGGTTTTGANANNTTGGGCCCCGAGGANNGGGGGGNNGNAAANGNGNGNNNNGAGAGAGNNNNGGAGGNNAGGGGGNNGNNANNGGNTTTTGGGGGGGGGNNNNNNGGNNGGNNNNGNNGGGNNNNNAGAGNGGGGNGGGGGNGGGNNNNGGAAGGNGNGGGGGGGGGNGNGGNNGGGNNGGGNNGGTGGGNNGGNNGNNGGNGGGGNNNGGGGGNGGNGNGGGGGGGGNNNNNGNGNGGNNNNGNNNGGNNGANNNNGNNNGNNNNAGNGGNGNNNNGAGNNNGGGNNNGGGGNGGGNNNNNNGGNNGGGGNGGAGCNNGGGNNNNANNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTCCCTGCGGGCGAT