ORFeome > pou5f3.3 ORF1 – XORFeome v1.0

pou5f3.3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pou5f3.3
Gene ID: 5903594
Gene Page ID: 5903503
ORF Xenbase ID: 17290083

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC070557
Original XGC clone length: 1281

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11024
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ825047
dbEST ID: 79642749
Trimmed Sequence: ATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAGACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGGATATTATACNGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTTGAGTCCCTGCAACTGAACCTTTCAAAATATGGTGTAAACTCAAACCCCCTAATTGGAGCCAATGGGCCTGGGAA
Full Trace Sequence: TAATGATGTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACCAGCCCATATTGTACAGCCAAACCTCCTTCCCCAACTTCACCTACAGCCCAGGAGTGGTGCAAGACGGGGGCAATTACCAGTATTTGGGCAACTACAATGCCCCGTCCTACCCGCAGCCGTTCTTCCATGTCCCTGTTATAAAATCAGAATTTGGTGCCCATGAGGAAGAAACGCCGGGGAGTTGCCATGCTGCTTCCTTTGACTGGAACCTGTACCCTCACTTTCAGATCTCTAACCAGGCGGCTTCCAACAGTTCTGGAGATCCAAGTCCAGAGGGAAGAACTGAGGAGGATGGTTCTGTCAGTGAAGGGAGGTCCTCCAGTTCCCCTTCCCCCAATTCTCCCCTGGTGCCTTCCTTTGCCCAATATTGGCATTATCCCTCCTGGCAGCAGGGGAACCTAACCAACCAAGCTCACACTCTTTTTGATGGGGGTGATGAGAAGCCCCAACAGTCTCGTCACAGTCCAACGGCCTCGCTAGGGAGTGGGGCGTCCAACACCGAGGATGAGGAGGTCCCCAGTGCCATCTCCAGTAGAGCAGAAAGAGGTCTCTGTAGTCCCTCTCCTAATAATGCCTCATGTGGCCCTGGAACTGAAGAGGATGGAATGACCCTTGAGGAGATGGAAGAGTTTGCCAAGGAGCTGAGACAGAAGCGGGTGGCACTGGGTTATACCCAAGGAGACATTGGCCACGCCCTGGGGATATTATACNGGAAGATGTTCAGCCAGACGACTATCTGCCGCTTTTGAGTCCCTGCAACTGAACCTTTCAAAATATGGTGTAAACTCAAACCCCCTAATTGGAGCCAATGGGCCTGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACCAGCCCATATTGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ830411
dbEST ID: 79648113
Trimmed Sequence: GCCGGTCAGGACCCCCATAGATATCCCCGGAGCCATGTGAGGGAACAGCTCATTCCTGGGGAAGGGAGGTGGGTAGAAGGTGGCTCGGTTGGGGTGTAGAGAGGCCAATCCATAGTCCTGGGAATTAGCTGGAATGGGGGTGAAAGAAATGTGTTCTGATTGGATGGATCCAGGACTGGCACCACCCACAAACTCATGCCCCTTGGACATTCTGAACTTGCTCTTCTCCTTCTGCCGCCGGTTGCAGAACCAGACCCTCACCACATCTTTCTCCAGACTCAGTTCTTTGGCAATTTCCGTCAGCTCCCTGGCACCAGGTTTCTGATTGCACATGAAGTGGCCCTCCAGTTGGCCCTTTAGAACAGTATCAAAGCAGGTCCTCATCTTCCGCTTGCGGTTCTGCTCCTCAATCTGGGCCTTGTGGATCATCTCCTGTAGGTTGTCATTATTCTCCGCCTCTCCCAGCCACTGCTCCAATAGGGGTTTGAGTTTACACATATTTTTGAAGGTCAGTTGCAGGGACTCAAAGCGGCAGATAGTCGTCTGGCTGAACATCTTCCCGTATAATATTCCCAGGGCGTGGCCAATGTCTCCTTGGGTATAAACCAGTGCCACCCCCTTCTGTTTCAGCTCCTTGGCAAACTCCTCCATCTCCTCAGGGGTCATTCCATCCCTCTTTAGTTTCCAGGGCCACCTGGAGGCATTAATAAGAAAAGGGAACAACAAAAAACTTCCTTTCTGCCTCCACCTGGAAAATGGGCCACTGGGGGGACCT
Full Trace Sequence: GGACCGGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCGGTCAGGACCCCCATAGATATCCCCGGAGCCATGTGAGGGAACAGCTCATTCCTGGGGAAGGGAGGTGGGTAGAAGGTGGCTCGGTTGGGGTGTAGAGAGGCCAATCCATAGTCCTGGGAATTAGCTGGAATGGGGGTGAAAGAAATGTGTTCTGATTGGATGGATCCAGGACTGGCACCACCCACAAACTCATGCCCCTTGGACATTCTGAACTTGCTCTTCTCCTTCTGCCGCCGGTTGCAGAACCAGACCCTCACCACATCTTTCTCCAGACTCAGTTCTTTGGCAATTTCCGTCAGCTCCCTGGCACCAGGTTTCTGATTGCACATGAAGTGGCCCTCCAGTTGGCCCTTTAGAACAGTATCAAAGCAGGTCCTCATCTTCCGCTTGCGGTTCTGCTCCTCAATCTGGGCCTTGTGGATCATCTCCTGTAGGTTGTCATTATTCTCCGCCTCTCCCAGCCACTGCTCCAATAGGGGTTTGAGTTTACACATATTTTTGAAGGTCAGTTGCAGGGACTCAAAGCGGCAGATAGTCGTCTGGCTGAACATCTTCCCGTATAATATTCCCAGGGCGTGGCCAATGTCTCCTTGGGTATAAACCAGTGCCACCCCCTTCTGTTTCAGCTCCTTGGCAAACTCCTCCATCTCCTCAGGGGTCATTCCATCCCTCTTTAGTTTCCAGGGCCACCTGGAGGCATTAATAAGAAAAGGGAACAACAAAAAACTTCCTTTCTGCCTCCACCTGGAAAATGGGCCACTGGGGGGACCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCGGTCAGGACCCCCA