ORFeome > ppa1 ORF1 – XORFeome v1.0

ppa1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ppa1
Gene ID: 985719
Gene Page ID: 985711
ORF Xenbase ID: 17290089

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC097793
Original XGC clone length: 615

Human orthology & disease relationships

NCBI Entrez ID: 5464
Ensembl gene IDs: ENSG00000180817
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,204000,207800,207900,215700,219500,248900,259700,267300,268000,300322,300323,311250,400042,601777,602722,602875,603896,608611

Library Location

Plate ID: GDExl11089
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ838412
dbEST ID: 79656114
Trimmed Sequence: ATGCAAGGCTACAGCGTAGAGGAAAGGGGGCGGCCGAATACCGCTGAATATAGGCTGTTTTTCAAGAATACAGATGGCAAATTCATTTCACCTTTTCATGACATCCCTCTGCATGCAAGAGCTGAACAGGACAGTGATGTGCCAGCGAAGAAATCAAAGACTAATTGGGATAAGAATGTGTTTAACATGGTGGTAGAGGTACCTCGTTGGACAAATGCTAAAATGGAGATTGCAACAAAAGAGCTTCTTAACCCTATTAAACAAGACATGAAAAAAGGGAAGCTTCGCTATGTCTCAAACATTTTTCCTCACAAAGGTTACATATGGAATTATGGCGCTCTTCCGCAGACCTGGGAAGATCCCAAGCACATTGACCATAATACCAAGTGCTGCGGTGATAATGATCCAATAGATGTCTGTGAAATTGGCTCCAAGGTTTGTGCAAGGGGTGATGTTATACAGGTGAAGGTTCTGGGGATTCTGGCTCTAGTGGATGAAGGCGAGACCGATTGGAAGGTAATAGCAATCAATATTGACGACCCTGATGCTGAGAAGTTTAATGACATAGAAAATGTAAAAAAAGCACAAACCCGGCTATCTACAAACAACTGTTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAAGGCTACAGCGTAGAGGAAAGGGGGCGGCCGAATACCGCTGAATATAGGCTGTTTTTCAAGAATACAGATGGCAAATTCATTTCACCTTTTCATGACATCCCTCTGCATGCAAGAGCTGAACAGGACAGTGATGTGCCAGCGAAGAAATCAAAGACTAATTGGGATAAGAATGTGTTTAACATGGTGGTAGAGGTACCTCGTTGGACAAATGCTAAAATGGAGATTGCAACAAAAGAGCTTCTTAACCCTATTAAACAAGACATGAAAAAAGGGAAGCTTCGCTATGTCTCAAACATTTTTCCTCACAAAGGTTACATATGGAATTATGGCGCTCTTCCGCAGACCTGGGAAGATCCCAAGCACATTGACCATAATACCAAGTGCTGCGGTGATAATGATCCAATAGATGTCTGTGAAATTGGCTCCAAGGTTTGTGCAAGGGGTGATGTTATACAGGTGAAGGTTCTGGGGATTCTGGCTCTAGTGGATGAAGGCGAGACCGATTGGAAGGTAATAGCAATCAATATTGACGACCCTGATGCTGAGAAGTTTAATGACATAGAAAATGTAAAAAAAGCACAAACCCGGCTATCTACAAACAACTGTTTGCCAACTTTCTTTGTACAAGTTGGCATTATAAGAAAGCATTGGTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAATAAAATCATTATTTGCATCCCACCTGACATCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAAGGCTACAGCGTAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838411
dbEST ID: 79656113
Trimmed Sequence: ACAGTTGCTTGTAGATAGCCGGGTTTGTGCTTTTTTTACATCTTCTATGTCATTAAACTTCTCAGCATCAGGGTCGTCAATATTGATTGCTATTACCTTCCAATCGGTCTCGCCTTCATCCACTAGAGCCAGAATCCCCAGAACCTTCACCTGTATAACATCACCCCTTGCACAAACCTTGGAGCCAATTTCACAGACATCTATTGGATCATTATCACCGCAGCACTTGGTATTATGGTCAATGTGCTTGGGATCTTCCCAGGTCTGCGGAAGAGCGCCATAATTCCATATGTAACCTTTGTGAGGAAAAATGTTTGAGACATAGCGAAGCTTCCCTTTTTTCATGTCTTGTTTAATAGGGTTAAGAAGCTCTTTTGTTGCAATCTCCATTTTAGCATTTGTCCAACGAGGTACCTCTACCACCATGTTAAACACATTCTTATCCCAATTATTCTTTGATTTCTTCCCTGGCGCATCACTGTCCTGTTCAGCTCTTGCATGCAGAGGGATGTCATGAGAAGGTGAAGTGAAATTGCCATCTGTATTCTTGAAAAACAGCCTATATTCAGCCGTATTCGGCCGCCCCCTTTTCCCCTCGCTGTACCCTGCATGGTGCCAGAGTTTTTTTACGAAAGTTGGGATATGAAAAAGCAATGGCTCATCATTTTGTTGCAGACGGACGGGGTCCCTATGAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAACACAAT
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGTTGCTTGTAGATAGCCGGGTTTGTGCTTTTTTTACATCTTCTATGTCATTAAACTTCTCAGCATCAGGGTCGTCAATATTGATTGCTATTACCTTCCAATCGGTCTCGCCTTCATCCACTAGAGCCAGAATCCCCAGAACCTTCACCTGTATAACATCACCCCTTGCACAAACCTTGGAGCCAATTTCACAGACATCTATTGGATCATTATCACCGCAGCACTTGGTATTATGGTCAATGTGCTTGGGATCTTCCCAGGTCTGCGGAAGAGCGCCATAATTCCATATGTAACCTTTGTGAGGAAAAATGTTTGAGACATAGCGAAGCTTCCCTTTTTTCATGTCTTGTTTAATAGGGTTAAGAAGCTCTTTTGTTGCAATCTCCATTTTAGCATTTGTCCAACGAGGTACCTCTACCACCATGTTAAACACATTCTTATCCCAATTATTCTTTGATTTCTTCCCTGGCGCATCACTGTCCTGTTCAGCTCTTGCATGCAGAGGGATGTCATGAGAAGGTGAAGTGAAATTGCCATCTGTATTCTTGAAAAACAGCCTATATTCAGCCGTATTCGGCCGCCCCCTTTTCCCCTCGCTGTACCCTGCATGGTGCCAGAGTTTTTTTACGAAAGTTGGGATATGAAAAAGCAATGGCTCATCATTTTGTTGCAGACGGACGGGGTCCCTATGAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAACACAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGTTGCTTGTAGATAGCC