ORFeome > ppdpf ORF2 – XORFeome v1.0

ppdpf ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ppdpf
Gene ID: 6252795
Gene Page ID: 959556
ORF Xenbase ID: 17290179

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123172
Original XGC clone length: 342

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ838139
dbEST ID: 79655841
Trimmed Sequence: ATGGCTGCCATTCCATCCAGTGGTTCACTTGTCGCAACCCATGATTATTACCGCAGACGCTTGGGATCCACTTCCAGCAACAGCTCATGTGGGAGTGTGGACTACTCTGGAGAAGTCATCCCTCACCACCCAGGTCTCCCGAAATCTGATCCTGGTCACTGGTGGGCCAGCTTCTTCTTTGGAAAACCCACCCATCCTGTCATGACAACGGTTTCAGAGTCCCCTGAGAACTCAGGAAGTTTCCGTATCACCAGTGGACTGGTTCCATGCGGTCTGGTTCAGGAGTCTGTGCTGAAGCAAAAAGTTGGTGACACAAAGTCTGACTCCAGCCCCTCTGCCTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCATTCCATCCAGTGGTTCACTTGTCGCAACCCATGATTATTACCGCAGACGCTTGGGATCCACTTCCAGCAACAGCTCATGTGGGAGTGTGGACTACTCTGGAGAAGTCATCCCTCACCACCCAGGTCTCCCGAAATCTGATCCTGGTCACTGGTGGGCCAGCTTCTTCTTTGGAAAACCCACCCATCCTGTCATGACAACGGTTTCAGAGTCCCCTGAGAACTCAGGAAGTTTCCGTATCACCAGTGGACTGGTTCCATGCGGTCTGGTTCAGGAGTCTGTGCTGAAGCAAAAAGTTGGTGACACAAAGTCTGACTCCAGCCCCTCTGCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTAAAAAAAAAAAAAAAAATCAATAATGTTACACCGAAAGCCCCGGGGGAAAAAAAGAAAAAGCTCCCACAAAACGGGGGTTGGGGTGTTCTCTGGTTGAGCGTGGGAAAGCCCAAAAAAAGGAAAAAAACCGGGGGTTGTTTTATGGTGTGAAAAGTGGGTGGGGGGGGCGCCCGGCCCAAAAATATAAAAAAAAAAAGAGGGGAAAACCCCGGGGGGTTTTTTTGTTTGTTTTTTTTTTTTTTTTGTATTAATAACACCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCATTCCATCCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838138
dbEST ID: 79655840
Trimmed Sequence: GGCAGAGGGGCTGGAGTCAGACTTTGTGTCACCAACTTTTTGCTTCAGCACAGACTCCTGAACCAGACCGCATGGAACCAGTCCACTGGTGATACGGAAACTTCCTGAGTTCTCAGGGGACTCTGAAACCGTTGTCATGACAGGATGGGTGGGTTTTCCAAAGAAGAAGCTGGCCCACCAGTGACCAGGATCAGATTTCGGGAGACCTGGGTGGTGAGGGATGACTTCTCCAGAGTAGTCCACACTCCCACATGAGCTGTTGCTGGAAGTGGATCCCAAGCGTCTGCGGTAATAATCATGGGTTGCGACAAGTGAACCACTGGATGGAATGGCAGCCATGG
Full Trace Sequence: GAAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAGAGGGGCTGGAGTCAGACTTTGTGTCACCAACTTTTTGCTTCAGCACAGACTCCTGAACCAGACCGCATGGAACCAGTCCACTGGTGATACGGAAACTTCCTGAGTTCTCAGGGGACTCTGAAACCGTTGTCATGACAGGATGGGTGGGTTTTCCAAAGAAGAAGCTGGCCCACCAGTGACCAGGATCAGATTTCGGGAGACCTGGGTGGTGAGGGATGACTTCTCCAGAGTAGTCCACACTCCCACATGAGCTGTTGCTGGAAGTGGATCCCAAGCGTCTGCGGTAATAATCATGGGTTGCGACAAGTGAACCACTGGATGGAATGGCAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTGNAAAAAAAAATAAAAATAAAAATAATATCTGGGACGTTAATGCGGGCGGCAAAAAAAACTAAAGGAAAAAAGGAAACAAGGGGCTGGTGTGACCGTTTGTTGGAGGGATGGGGCCCGAGACCAAGGGAACAAACCGGTGGCTGTTAAAATTGGGTGGCCTTCTTTTTTCGTTCCGGCTTGTTCCAAACAATAACCAACCAACAGAGGTGGAAGGCCGACGTCCGGGTTTTGTGGGTTTATTATATTGTTTTTTTTGGGGACTCCCTCCCCCCCGCGGGGGGCCCCCANNCCCACCCCCACACCNTTCCTCTGGCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAGAGGGGCTGGAGT