ORFeome > ppib ORF1 – XORFeome v1.0

ppib ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ppib
Gene ID: 855975
Gene Page ID: 855963
ORF Xenbase ID: 17290209

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054168
Original XGC clone length: 651

Human orthology & disease relationships

NCBI Entrez ID: 5479
Ensembl gene IDs: ENSG00000166794,LRG_10
Directly associated (OMIM) disease MIM numbers: 259440
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ839162
dbEST ID: 79656864
Trimmed Sequence: ATGCTGCGGCCGCTGGAGAGAAACATGAAGTTACTGTTTGCTGCTGCGCTTATCGCGGGCTCCGTGATCTTCTTGCTCTTCCCTGGGAGCTCAGTGGCAGATGACAAGAAGAAAGGGCCGAAGGTGACCGATAAGGTATACTTTGATTTAAAGATCGGTGATGAGGAAGTAGGACGTATAGTAATCGGTCTTTTTGGAAAAACTGTTCCTAAGACAGTTGAAAACTTTGTAACCTTGGCAACCGGAGAGAAAGGATATGGTTACAAAGGCAGCAAGTTCCACCGTGTGATCAAAGAATTTATGATCCAAGGAGGAGATTTTACTCGTGGAGATGGTACTGGAGGAAAAAGCATTTATGGAGACAGGTTTCCAGATGAGAACTTCAAGCTGAAGCACTATGGCCCATTTTGGCTTAGCATGGCTAATGCTGGCAAAGATACTAACGGTTCTCAGTTCTTCATTACAACTGTCAAGACTCCATGGCTTGATGGGAAACATGTGGTGTTTGGCAAAGTTCTGGAAGGCACGGAAATTGTGCGAAAGATTGAATCCACTAAAACAGATGGTCGGGATAAACCACTTAAAGATGTGGTGATTGCAGACTGTGGAAAGATTGAGGTGGAAAAGCCATTTGCATTTGCCAAAGAGTT
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGCGGCCGCTGGAGAGAAACATGAAGTTACTGTTTGCTGCTGCGCTTATCGCGGGCTCCGTGATCTTCTTGCTCTTCCCTGGGAGCTCAGTGGCAGATGACAAGAAGAAAGGGCCGAAGGTGACCGATAAGGTATACTTTGATTTAAAGATCGGTGATGAGGAAGTAGGACGTATAGTAATCGGTCTTTTTGGAAAAACTGTTCCTAAGACAGTTGAAAACTTTGTAACCTTGGCAACCGGAGAGAAAGGATATGGTTACAAAGGCAGCAAGTTCCACCGTGTGATCAAAGAATTTATGATCCAAGGAGGAGATTTTACTCGTGGAGATGGTACTGGAGGAAAAAGCATTTATGGAGACAGGTTTCCAGATGAGAACTTCAAGCTGAAGCACTATGGCCCATTTTGGCTTAGCATGGCTAATGCTGGCAAAGATACTAACGGTTCTCAGTTCTTCATTACAACTGTCAAGACTCCATGGCTTGATGGGAAACATGTGGTGTTTGGCAAAGTTCTGGAAGGCACGGAAATTGTGCGAAAGATTGAATCCACTAAAACAGATGGTCGGGATAAACCACTTAAAGATGTGGTGATTGCAGACTGTGGAAAGATTGAGGTGGAAAAGCCATTTGCATTTGCCAAAGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGGCTTATCCATTTGTTGCCACGGACCAGGTCACTAATCGTCAAAAATAAAATCATTTATTTTGCCCTTCCAGCCTGAAAATCCCCCTATAGGTGAAGTTCGTATATATAAAAAGAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCGGCCGCTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839161
dbEST ID: 79656863
Trimmed Sequence: CTCTTTGGCAATTGCAAATGGCTTTTCCACCTCAATCTTTCCACAGTCTGCAATCACCACATCTTTAAGTGGTTTATCCCGACCATCTGTTTTAGTGGATTCAATCTTTCGCACAATTTCCGTGCCTTCCAGAACTTTGCCAAACACCACATGTTTCCCATCAAGCCATGGAGTCTTGACAGTTGTAATGAAGAACTGAGAACCGTTAGTATCTTTGCCAGCATTAGCCATGCTAAGCCAAAATGGGCCATAGTGCTTCAGCTTGAAGTTCTCATCTGGAAACCTGTCTCCATAAATGCTTTTTCCTCCAGTACCATCTCCACGAGTAAAATCTCCTCCTTGGATCATAAATTCTTTGATCACACGGTGGAACTTGCTGCCTTTGTAACCATATCCTTTCTCTCCGGTTGCCAAGGTTACAAAGTTTTCAACTGTCTTAAGAACAGTTTTTCCAAAAAGACCGATTACTATACGTCCTACTTCCTCATCACCGATCTTTAAATCAAAGTATACCTTATCGGTCACCTTCGGCCCTTTCTTCTTGTCATCTGCCACTGAGCTCCCAGGGAAGAGCAAGAAAAATCACGGAGCCCGCGAATAGCGCAACAACAAAAAGTAAACTTCATGGTTCCCTCCACCGGCCGCAGCATGGGGGC
Full Trace Sequence: GGGAAATAANGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTTGGCAATTGCAAATGGCTTTTCCACCTCAATCTTTCCACAGTCTGCAATCACCACATCTTTAAGTGGTTTATCCCGACCATCTGTTTTAGTGGATTCAATCTTTCGCACAATTTCCGTGCCTTCCAGAACTTTGCCAAACACCACATGTTTCCCATCAAGCCATGGAGTCTTGACAGTTGTAATGAAGAACTGAGAACCGTTAGTATCTTTGCCAGCATTAGCCATGCTAAGCCAAAATGGGCCATAGTGCTTCAGCTTGAAGTTCTCATCTGGAAACCTGTCTCCATAAATGCTTTTTCCTCCAGTACCATCTCCACGAGTAAAATCTCCTCCTTGGATCATAAATTCTTTGATCACACGGTGGAACTTGCTGCCTTTGTAACCATATCCTTTCTCTCCGGTTGCCAAGGTTACAAAGTTTTCAACTGTCTTAAGAACAGTTTTTCCAAAAAGACCGATTACTATACGTCCTACTTCCTCATCACCGATCTTTAAATCAAAGTATACCTTATCGGTCACCTTCGGCCCTTTCTTCTTGTCATCTGCCACTGAGCTCCCAGGGAAGAGCAAGAAAAATCACGGAGCCCGCGAATAGCGCAACAACAAAAAGTAAACTTCATGGTTCCCTCCACCGGCCGCAGCATGGGGGCCAACTTTTTGGAACAAAGTTGGGCATTATAAAAAAAGCATTGCTCAACAATTTTGTTTGAAACAAAAAAGGTCCCTAATCAATTCAAAATAAAAAATCAATAAATTTGGGCGCGCCCGAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTTGGCAATTGCAAATGGCT