ORFeome > ppie ORF1 – XORFeome v1.0

ppie ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ppie
Gene ID: 979642
Gene Page ID: 979638
ORF Xenbase ID: 17290221

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123371
Original XGC clone length: 885

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGCCCCACATAAATAGATTATTATTATTTATTGATGATAGACGCTGTTCTTTGCTACAAATTAGTTGAACAATGCTGTTTTTATTATGCCGTCTTTGTTCAAAAAAGTTGGCAGCATGGCGGTGATGGGAGAGGCTATGTTGGTCTCTCTGCTTCCCATCCTCCGACTCCTCCTCCTAGATTAGCGTCCTGAGACGGTATTTCACTGACAGCCTTCGAGAGATTACAAGGAATGAGTGAACATTTTGGCTTGATCTGTCCAACTCAAAGAAAGGGCTGTGAAGCTGTGTGTAATTGAGGCAAAGGCTACCCCTTAAGGAGTTTATACGAATTTTATGGAGACTCTTAGACTGATGCCTTAGATATTGACTGGCAATGACTAAGGCATTTGCACGCCTAATCGAAGAGGTGCACTCTGAGTACATGATGGTAAATGTGGACTCCAACGCTCACCCAAATAATTCCTTTCACTGCCCTCTTACCCTGTATTCCCTTAATATCTATTATCTTCATATCTTTTTTATATATCTTCTCATTATTGTAACCCGGATTACAATTGTGAATACCACAAACCTGGGACATTCAAGGAAGTCTAGTGTCCATTTCCTTCGTTGCAAATCACCAATTAACGCAGTTGGCTCAGCCACTTTCCTGGCATCTGATTGTTTATTGTCTATAAAAGGGAAGAAACTGAATCAAGCCGTCTTAGGGTCTAGAATACGGACAATCCTCTGTTTGTATAAATCCCCCATCGTGCAAAAAACTACAAAAGAGTTGCAATTAAAAGTTCTGTTCCTTGGAACCACAAAAAAAGAAGAAAAAATCCCATTACAGGACGGAGCCGCACTCAGTTTAAAAAGTAAGAAAAAAAAAAAGGGAGAACCCGAAGTTGTAACACTATGTTTAAGTTCTATGTGGATAATGTCCGCACAATGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACTTAGGTGGACTAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837572
dbEST ID: 79655274
Trimmed Sequence: CACATACTCCCCACAGTCTGATATGATGATCTTCTGTTTTGGTTTTCCATCTTTGCCGCCTTGCGCCTCCATCTGCCTTACAACATCCATCCCCTCCATCACTTCCCCGAACACCACATGCTTCCCATCAAGCCAATCTGTTTTGTCGCATGTGATGAAGAACTGTGATCCATTTGTGTTGACACCAGAATTCGCCATGGACAGCAATCCTGGTCCAGTGTGCTTTAAAATAAAGTTTTCATCATCGAACTTTCTACCATAAATGGATTTTCCTCCAGTGCCATTGTGGTTGGTGAAGTCTCCAGCCTGGCACATGAACTGCGGGATGATTCTGTGAAAACTGCTGCCTTTAAAGCCAAATCCCTTTTCATGGTTGCACAGACAGCGGAAATTCTCTACTGTCATTGGAACAATATCAGCTCTCAGCAGGAATCGGATTCGTCCAGCAGGCTTGTTCCCAATCTTGATGTCCATGTAGACTTGGGGATTTGCCCGAACTTTTTTAGGAGGAGGTTCTCCCTCTTGGGCTGCAGGTTTTGGAGCTTCTACCCCTTCTCCTTCTTCATTCTCTTCCAGAGTTTTTCCAGAAAATTTCTTTACCCTGTCTTCATCCGACCCAAAAGCCTTGGATGAACGTTCTTGTAATCGCAAAGGCCTTTGCTAAATTAACTCAAAATTGTTCTACCAAAACAGTTCCTAATTCTTCCTTGTTTAAAATTTGGCAGCAGCGTGCGTCCGGCTGGGGGAGGCCTAGAGCCCTGGGGAAAAGG
Full Trace Sequence: GGGGAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACATACTCCCCACAGTCTGATATGATGATCTTCTGTTTTGGTTTTCCATCTTTGCCGCCTTGCGCCTCCATCTGCCTTACAACATCCATCCCCTCCATCACTTCCCCGAACACCACATGCTTCCCATCAAGCCAATCTGTTTTGTCGCATGTGATGAAGAACTGTGATCCATTTGTGTTGACACCAGAATTCGCCATGGACAGCAATCCTGGTCCAGTGTGCTTTAAAATAAAGTTTTCATCATCGAACTTTCTACCATAAATGGATTTTCCTCCAGTGCCATTGTGGTTGGTGAAGTCTCCAGCCTGGCACATGAACTGCGGGATGATTCTGTGAAAACTGCTGCCTTTAAAGCCAAATCCCTTTTCATGGTTGCACAGACAGCGGAAATTCTCTACTGTCATTGGAACAATATCAGCTCTCAGCAGGAATCGGATTCGTCCAGCAGGCTTGTTCCCAATCTTGATGTCCATGTAGACTTGGGGATTTGCCCGAACTTTTTTAGGAGGAGGTTCTCCCTCTTGGGCTGCAGGTTTTGGAGCTTCTACCCCTTCTCCTTCTTCATTCTCTTCCAGAGTTTTTCCAGAAAATTTCTTTACCCTGTCTTCATCCGACCCAAAAGCCTTGGATGAACGTTCTTGTAATCGCAAAGGCCTTTGCTAAATTAACTCAAAATTGTTCTACCAAAACAGTTCCTAATTCTTCCTTGTTTAAAATTTGGCAGCAGCGTGCGTCCGGCTGGGGGAGGCCTAGAGCCCTGGGGAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATACTCCCCACAGTC