ORFeome > ppil1 ORF1 – XORFeome v1.0

ppil1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ppil1
Gene ID: 6256023
Gene Page ID: 963800
ORF Xenbase ID: 17290233

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078520
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ839906
dbEST ID: 79657608
Trimmed Sequence: ATGTCTGGAATCCCACATGATACATGGCAGCCGCCGCACGTGTTAGTAGAGACAAGCATGGGTACGATTACTGTGGAGCTGTATTGGCTGCACGCTCCTGTGACATGTAAAAACTTCGCAGAGCTTGCTCGGAGAGGGTATTATAATGGAACGAAATTCCACCGGCTTATCAAAGACTTTATGGCACAGGGAGGAGACCCAACTGGAACAGGAAGGGGAGGAGCTTCTATATATGGAAAACAATTTGAAGATGAAATTCATCCAGACCTAAAATTTACAGGAGCAGGCATTCTAGCAATGGCAAATGCTGGTCCAGACAGCAATGGGAGCCAATTTTTCCTAACTCTGGCACCTACACCGTGGCTGGATGGAAAACACAGCATTTTTGGACGTGTGAGTCATGGTCTGGGGACACTAAACAGACTTGGAATGGTGGAAACAGATTCTCAGGACCGACCACTTGATGAAGTTCAAGTATTGCGGGCTTATCCATCTGGCTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAATCCCACATGATACATGGCAGCCGCCGCACGTGTTAGTAGAGACAAGCATGGGTACGATTACTGTGGAGCTGTATTGGCTGCACGCTCCTGTGACATGTAAAAACTTCGCAGAGCTTGCTCGGAGAGGGTATTATAATGGAACGAAATTCCACCGGCTTATCAAAGACTTTATGGCACAGGGAGGAGACCCAACTGGAACAGGAAGGGGAGGAGCTTCTATATATGGAAAACAATTTGAAGATGAAATTCATCCAGACCTAAAATTTACAGGAGCAGGCATTCTAGCAATGGCAAATGCTGGTCCAGACAGCAATGGGAGCCAATTTTTCCTAACTCTGGCACCTACACCGTGGCTGGATGGAAAACACAGCATTTTTGGACGTGTGAGTCATGGTCTGGGGACACTAAACAGACTTGGAATGGTGGAAACAGATTCTCAGGACCGACCACTTGATGAAGTTCAAGTATTGCGGGCTTATCCATCTGGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGAATACCCCCTAAATGAGTCTGGGTACATGGTTCCTAACAAAAAAATGGAAACCTATGCCCGTGTCTTAAAACCTTAAATATTTCAAAAAAAAAAAAAGCATCTGCTCCGATACGTGGGTTCCTTTATTATACCTTTTTTTATAAGAAAAAAAACCCCCCACCACATAAAAATAAACCCCGTGCCGCGGGGGTTAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAATCCCACATGATA

Sequences - 3ʹ (reverse) EST

Accession: JZ839905
dbEST ID: 79657607
Trimmed Sequence: GCCAGATGGATAAGCCCGCAATACTTGAACTTCATCAAGTGGTCGGTCCTGAGAATCTGTTTCCACCATTCCAAGTCTGTTTAGTGTCCCCAGACCATGACTCACACGTCCAAAAATGCTGTGTTTTCCATCCAGCCACGGTGTAGGTGCCAGAGTTAGGAAAAATTGGCTCCCATTGCTGTCTGGACCAGCATTTGCCATTGCTAGAATGCCTGCTCCTGTAAATTTTAGGTCTGGATGAATTTCATCTTCAAATTGTTTTCCATATATAGAAGCTCCTCCCCTTCCTGTTCCAGTTGGGTCTCCTCCCTGTGCCATAAAGTCTTTGATAAGCCGGTGGAATTTCGTTCCATTATAATACCCTCTCCGAGCAAGCTCTGCGAAGTTTTTACATGTCACAGGAGCGTGCAGCCAATACAGCTCCACAGTAATCGTACCCATGCTTGTCTCTACTAACACGTGCGGCGGCTGCCATGTATCATGTGGGATTCCAGACATGG
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCAGATGGATAAGCCCGCAATACTTGAACTTCATCAAGTGGTCGGTCCTGAGAATCTGTTTCCACCATTCCAAGTCTGTTTAGTGTCCCCAGACCATGACTCACACGTCCAAAAATGCTGTGTTTTCCATCCAGCCACGGTGTAGGTGCCAGAGTTAGGAAAAATTGGCTCCCATTGCTGTCTGGACCAGCATTTGCCATTGCTAGAATGCCTGCTCCTGTAAATTTTAGGTCTGGATGAATTTCATCTTCAAATTGTTTTCCATATATAGAAGCTCCTCCCCTTCCTGTTCCAGTTGGGTCTCCTCCCTGTGCCATAAAGTCTTTGATAAGCCGGTGGAATTTCGTTCCATTATAATACCCTCTCCGAGCAAGCTCTGCGAAGTTTTTACATGTCACAGGAGCGTGCAGCCAATACAGCTCCACAGTAATCGTACCCATGCTTGTCTCTACTAACACGTGCGGCGGCTGCCATGTATCATGTGGGATTCCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATATAAAAGCCGAGCTTATAAATGGACGTCGTTTACAAATCTTGGGACATGAGAGTTTCCCGGGCAGGCCCAAACAGGGTCTCGAGTACACACATATTTTAAAAAAGCCCCCAAAACAAAAAAACTACCCGGGGTGGGGGTGTTTGGTTGGGGGAGAGGACAGCGAAAACAGAGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCAGATGGATAAGCCCGCAA