ORFeome > ppm1a ORF1 – XORFeome v1.0

ppm1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ppm1a
Gene ID: 852658
Gene Page ID: 852653
ORF Xenbase ID: 17290257

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042302
Original XGC clone length: 1152

Human orthology & disease relationships

NCBI Entrez ID: 5494
Ensembl gene IDs: ENSG00000100614
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114550,125853,132600,155255,608615

Library Location

Plate ID: GDExl11007
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ823604
dbEST ID: 79641306
Trimmed Sequence: ATGGGAGCATTTTTAGATAAGCCAAAGATGGAGAAGCATAATGCTCATGGGCAGGGCAATGAACTGCGGTATGGGCTTAGTAGCATGCAAGGTTGGCGCGTTGAAATGGAAGATGCCCATACAGCTGCTATTGGGCTACCAAATGGACTTGATGCATGGTCATTTTTTGCGGTCTATGACGGACACGCTGGATCCCAGGTTGCCAAGTACTGCTGTGAGCATTTGCTGGATCACATCACAAGCAACCAGGATTTCAAAGGGACAGATGGACATCTGTCTGTGTGGAGTGTAAAAAATGGAATCAGAACCGGATTTCTCCAGATTGATGAACATATGAGGGTAATCTCCGAGAAGAAACATGGCGCCGACAGAAGTGGATCGACGGCTGTTGGGGTGATGCTCTCCCCAAATCACATTTACTTTATCAACTGTGGAGACTCCAGAGGTTTACTTTGCAGGAGCAAGAAAGTGCATTTCTTTACACAGGATCATAAACCAAGCAATCCTCTCGAAAAGGAGCGCATACAAAATGCCGGGGGCTCTGTGATGATTCAACGTGTAAACGGGTCGCTTGCTGTTTCAAGGGCTCTGGGTGACTTTGACTACAAATGTGTCCATGGAAAAGGCCCTACGGAGCAGCTTGTTTCGCCTGAGCCTGAAGTTTATGAAATTGAGCGTTCAGAAGAAGATGACCAGTTTATCATTTTGGCATGTGATGGNTATTTGGGATGTCATGGGAAAACGAAGAGCTGTGGTGGATTTTGTGGGGTTCAAGGACTGTAAGTT
Full Trace Sequence: TAATGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGCATTTTTAGATAAGCCAAAGATGGAGAAGCATAATGCTCATGGGCAGGGCAATGAACTGCGGTATGGGCTTAGTAGCATGCAAGGTTGGCGCGTTGAAATGGAAGATGCCCATACAGCTGCTATTGGGCTACCAAATGGACTTGATGCATGGTCATTTTTTGCGGTCTATGACGGACACGCTGGATCCCAGGTTGCCAAGTACTGCTGTGAGCATTTGCTGGATCACATCACAAGCAACCAGGATTTCAAAGGGACAGATGGACATCTGTCTGTGTGGAGTGTAAAAAATGGAATCAGAACCGGATTTCTCCAGATTGATGAACATATGAGGGTAATCTCCGAGAAGAAACATGGCGCCGACAGAAGTGGATCGACGGCTGTTGGGGTGATGCTCTCCCCAAATCACATTTACTTTATCAACTGTGGAGACTCCAGAGGTTTACTTTGCAGGAGCAAGAAAGTGCATTTCTTTACACAGGATCATAAACCAAGCAATCCTCTCGAAAAGGAGCGCATACAAAATGCCGGGGGCTCTGTGATGATTCAACGTGTAAACGGGTCGCTTGCTGTTTCAAGGGCTCTGGGTGACTTTGACTACAAATGTGTCCATGGAAAAGGCCCTACGGAGCAGCTTGTTTCGCCTGAGCCTGAAGTTTATGAAATTGAGCGTTCAGAAGAAGATGACCAGTTTATCATTTTGGCATGTGATGGNTATTTGGGATGTCATGGGAAAACGAAGAGCTGTGGTGGATTTTGTGGGGTTCAAGGACTGTAAGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGCATTTTTAGATAAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ828903
dbEST ID: 79646605
Trimmed Sequence: CCACATATCATCTGTTGATGCAGAATCAGTGTCATCATTTCTATATGGATTCAATCTGTTGTACACTGCTTCAATCACACTCCGTTTGCTGGCCAATTCGCCCCCAGGTGGGAGATGAGGGATGTTCTCGGAGGCTAATGTGCGCATCACATGGACTAAGTCTGGTACACCTTCTTCACCCTGCTTCTTTATGATGTCTTCTACTCTGCCTTCCAGGTACTTGTCCAGTTCCGCCTCCCTTTTCACTGCCTCGGGCAATACTTTTGGAGCACTTGGAAAACAGATCAGTATGACACTCATGTTGTCTCTGCTTCCCTTGTACAGGCAGGTGTCCACTATTTCATTGCACACCCTTTCAAGGTCATCAGTAACTTCAAGTCTTGACCCCACAAAATCACACAGCTCTTCGTTTCCCATGACATCCCAAATACCATCACATGCCAAAATGATAAACTGGTCATCTTCTTCTGAACGCTCAATTTCATAAACTTCAGGCTCAGGCGAAACAAGCTGCTCCGTAAGGCCTTTTCCATGGACACATTTGTAGTCAAAGTCACCCAGAGCCCTTGAAACAGCAAGCGACCCGTTTACACGTTGAATCATCACAGAGCCCCCGGCATTTTGTATGCGCTCCTTTTTCAAAAGGATTGCCTTGGTTTATGAATCCTGTGGTAAAGAAA
Full Trace Sequence: CCGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCACATATCATCTGTTGATGCAGAATCAGTGTCATCATTTCTATATGGATTCAATCTGTTGTACACTGCTTCAATCACACTCCGTTTGCTGGCCAATTCGCCCCCAGGTGGGAGATGAGGGATGTTCTCGGAGGCTAATGTGCGCATCACATGGACTAAGTCTGGTACACCTTCTTCACCCTGCTTCTTTATGATGTCTTCTACTCTGCCTTCCAGGTACTTGTCCAGTTCCGCCTCCCTTTTCACTGCCTCGGGCAATACTTTTGGAGCACTTGGAAAACAGATCAGTATGACACTCATGTTGTCTCTGCTTCCCTTGTACAGGCAGGTGTCCACTATTTCATTGCACACCCTTTCAAGGTCATCAGTAACTTCAAGTCTTGACCCCACAAAATCACACAGCTCTTCGTTTCCCATGACATCCCAAATACCATCACATGCCAAAATGATAAACTGGTCATCTTCTTCTGAACGCTCAATTTCATAAACTTCAGGCTCAGGCGAAACAAGCTGCTCCGTAAGGCCTTTTCCATGGACACATTTGTAGTCAAAGTCACCCAGAGCCCTTGAAACAGCAAGCGACCCGTTTACACGTTGAATCATCACAGAGCCCCCGGCATTTTGTATGCGCTCCTTTTTCAAAAGGATTGCCTTGGTTTATGAATCCTGTGGTAAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCACATATCATCTGTTGATGC