ORFeome > ppt1 ORF1 – XORFeome v1.0

ppt1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ppt1
Gene ID: 6254984
Gene Page ID: 923069
ORF Xenbase ID: 17290599

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129713
Original XGC clone length: 900

Human orthology & disease relationships

NCBI Entrez ID: 5538
Ensembl gene IDs: ENSG00000131238,LRG_690
Directly associated (OMIM) disease MIM numbers: 256730
Indirectly associated (Lage, et al.) disease MIM numbers: 209920,256730

Library Location

Plate ID: GDExl11091
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ838690
dbEST ID: 79656392
Trimmed Sequence: ATGGCTGCGTGGTGGGCTCTTGCGCTGACAGCTCTGGTTCTGACTCTGAATGATGGGAAGGCAGAAGCGGACCCGGTACCGTTAGTTATTTGGCACGGAATGGGAGATTCCTGTTGCAACCCCTTCAGCATGGGGGCAGTGAAGAAAATGGTGGAGACGCAGATTCCAGGGATATATGTTCTTTCACTGAAGATTGGCAACAGCATCCCAGAGGACATGGAAAACAGCTTCTTCCTCAATGTGAATGAGCAGGTGGAAGGTGTTTGCAAAGAGCTAGCCCAAAATCCTGCACTGAAAAATGGATATAACAGTATGGGATTTTCTCAAGGAGGGCAATTTTTGAGAGCAGTGGCTCAGAGATGTCCTTCTCCACCTATGAGGAATCTGATTTCTATTGAAGGACGACATCGAGGAGTCTATGGATTTCCACGAGGTCCAGGAGAAATTTCCCATATGTGTGACTGGATAAGAAATTTCTGAATCGTGGTGCCGGCGCAAGAGATATAGAAGGCACCTGGTGGGGGGTGAATTTGTATGCCGAGGAGGTAAGTGAGGAGGAATAGAGAAAAGGGCAGTGAGTGTCGTAGGCGAACGCAATCCACGGAAGGCAAGGGGAGTGAAAGTAGGAAAAGGAAGAACCCAGCTGTTGAAAAAGGTTGGGAATGGGTGGGGGTGTGGTAAAAGAAAGCTGGGGGGGAGCCGGGGCCGAGCCGCGGGGGTTGGGGGGGTGGGGGGGGGCGATGGGTAGCCGAGTGGGGGCGCCCGGGAGAGGGGGGGGGAGGGGGGTGGGGGGGGGGGG
Full Trace Sequence: TCGTGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGTGGTGGGCTCTTGCGCTGACAGCTCTGGTTCTGACTCTGAATGATGGGAAGGCAGAAGCGGACCCGGTACCGTTAGTTATTTGGCACGGAATGGGAGATTCCTGTTGCAACCCCTTCAGCATGGGGGCAGTGAAGAAAATGGTGGAGACGCAGATTCCAGGGATATATGTTCTTTCACTGAAGATTGGCAACAGCATCCCAGAGGACATGGAAAACAGCTTCTTCCTCAATGTGAATGAGCAGGTGGAAGGTGTTTGCAAAGAGCTAGCCCAAAATCCTGCACTGAAAAATGGATATAACAGTATGGGATTTTCTCAAGGAGGGCAATTTTTGAGAGCAGTGGCTCAGAGATGTCCTTCTCCACCTATGAGGAATCTGATTTCTATTGAAGGACGACATCGAGGAGTCTATGGATTTCCACGAGGTCCAGGAGAAATTTCCCATATGTGTGACTGGATAAGAAATTTCTGAATCGTGGTGCCGGCGCAAGAGATATAGAAGGCACCTGGTGGGGGGTGAATTTGTATGCCGAGGAGGTAAGTGAGGAGGAATAGAGAAAAGGGCAGTGAGTGTCGTAGGCGAACGCAATCCACGGAAGGCAAGGGGAGTGAAAGTAGGAAAAGGAAGAACCCAGCTGTTGAAAAAGGTTGGGAATGGGTGGGGGTGTGGTAAAAGAAAGCTGGGGGGGAGCCGGGGCCGAGCCGCGGGGGTTGGGGGGGTGGGGGGGGGCGATGGGTAGCCGAGTGGGGGCGCCCGGGAGAGGGGGGGGGAGGGGGGTGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGTGGTGGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838689
dbEST ID: 79656391
Trimmed Sequence: GTGCAGAAAGGGAATTATATTCTTGTTAAACCACTCTTGTGAGAATTGCAGGTGATTTCCTTCCACTCCTAGAAACACCAGCTTTCCCGCTTTTTCCATTTCCTTAAGCCCCAAACGATCCTCAGTATACAAACTGCTTTCCTGTAATCTGATAGTCTCTTTGCTTTGTCCAGGTTTGTAGAACCCAAACCATTCTGTATCGGGAGGATCCACCATGGTGTCATTAAGAAATTTCACCATCACAAACTTTTCCAACAGTTGGAGATTCTTTTTGTAACTCTCATTCACATGCCTCTCCTGATTGATGTCTGCTAGGAAAATACTGCCATTTCTGTATTCCTCTTCATTTATTGGGTCGTGCCAATATTCAGCTTGCACCAGGTGATTTTGTACATCTCTAGTGTAGGCACCAAGATTCAGAAACTTTCTTATCAAGTCACACATATGGGAAATTTCTCCTGGACATCGTGGAAATCCATAGACTCCTTGATGTTGTCCTCCCATAGAAATCAGATTCCTCATAGGTGGAGAAGGACATCTCCGAACCACTGCTCTCAAAAATTGCCCTCCTGAGAAAATCCAATCCTGTTATATCCTTTTTCCTTGCAGGAGTTGGGGTTGGCTCCTTTCAAACCCCCTCCCACCCGCTCTTTTCCATTCATCGAAAAAGCTGGTTTTCCATCTCTTCTGCGGAATGCGGTTGGCAAATACTTATTTTAAAAAAACAAAATTACCATGGGGAATCGGGGAGTTCCCGGGCCTTTTCTT
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCAGAAAGGGAATTATATTCTTGTTAAACCACTCTTGTGAGAATTGCAGGTGATTTCCTTCCACTCCTAGAAACACCAGCTTTCCCGCTTTTTCCATTTCCTTAAGCCCCAAACGATCCTCAGTATACAAACTGCTTTCCTGTAATCTGATAGTCTCTTTGCTTTGTCCAGGTTTGTAGAACCCAAACCATTCTGTATCGGGAGGATCCACCATGGTGTCATTAAGAAATTTCACCATCACAAACTTTTCCAACAGTTGGAGATTCTTTTTGTAACTCTCATTCACATGCCTCTCCTGATTGATGTCTGCTAGGAAAATACTGCCATTTCTGTATTCCTCTTCATTTATTGGGTCGTGCCAATATTCAGCTTGCACCAGGTGATTTTGTACATCTCTAGTGTAGGCACCAAGATTCAGAAACTTTCTTATCAAGTCACACATATGGGAAATTTCTCCTGGACATCGTGGAAATCCATAGACTCCTTGATGTTGTCCTCCCATAGAAATCAGATTCCTCATAGGTGGAGAAGGACATCTCCGAACCACTGCTCTCAAAAATTGCCCTCCTGAGAAAATCCAATCCTGTTATATCCTTTTTCCTTGCAGGAGTTGGGGTTGGCTCCTTTCAAACCCCCTCCCACCCGCTCTTTTCCATTCATCGAAAAAGCTGGTTTTCCATCTCTTCTGCGGAATGCGGTTGGCAAATACTTATTTTAAAAAAACAAAATTACCATGGGGAATCGGGGAGTTCCCGGGCCTTTTCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCAGAAAGGGAATTATATTCTT