ORFeome > prdm4 ORF1 – XORFeome v1.0

prdm4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prdm4
Gene ID: 958487
Gene Page ID: 958480
ORF Xenbase ID: 17290665

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043864
Original XGC clone length: 2253

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ823795
dbEST ID: 79641497
Trimmed Sequence: ATGCATTACAGAATGAATGAGCTGAACCTCAGCACTGTGGGGATGGACCAGCTGACATCTTCCTCCGTTACCAATTCTCTCCCGGTCTCAGGGAGTCATCTTGGGCTTTCTGGCTCCCCTCCACACAATACTCTTCCAGCACCAGGTTTACCAGTGGCAATCCCGAACCTGGGTCCATCTTTAAGCTCTCTCCCTTCTGCCCTCTCAGTGATGCTTCCCATGGGTATAGGAGACCGCGGTGTGATGTGTGGTCTCCCAGAGAGGAACTACCCCCTTCCTCCTCCGCCTTATCCTCACCTGGAGAGCAGCTACTTCAGGCATATATTGCCAGGAATCCTCTCGTATCTAGCTGACCGACCCCCGCCGCAGTACATACACCCCGGCTCACTAAACGTCGACGGCCTTTCGGTTTCCATCGCTCCTCAGCCTCTGGACCCTTATCAGCCTGGGGGATCTGTGGGCTTAGAGACTGGAATTGGATCGTTAGACTCTCGCTCGGTTGCTGGGCACACAACACAGAGCCTGCACCCCAGTGATAGTCACGAGCTGGACGCTGCGATTACTATGGGTAGTGTCTCCAGAGTTAACAGTCCCATCTCATCGGACGGCATTACAGAAGAGCTGAGCATGGAAGGAGTCGCAGCAGAGCACGGGCAGATCTCTAACGTCTCTCGCTCTCATGAGCCCCTCACTGTGGATGGGAGTCTACCCCCTGATGCTGGTGTGTTC
Full Trace Sequence: GGGACAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATTACAGAATGAATGAGCTGAACCTCAGCACTGTGGGGATGGACCAGCTGACATCTTCCTCCGTTACCAATTCTCTCCCGGTCTCAGGGAGTCATCTTGGGCTTTCTGGCTCCCCTCCACACAATACTCTTCCAGCACCAGGTTTACCAGTGGCAATCCCGAACCTGGGTCCATCTTTAAGCTCTCTCCCTTCTGCCCTCTCAGTGATGCTTCCCATGGGTATAGGAGACCGCGGTGTGATGTGTGGTCTCCCAGAGAGGAACTACCCCCTTCCTCCTCCGCCTTATCCTCACCTGGAGAGCAGCTACTTCAGGCATATATTGCCAGGAATCCTCTCGTATCTAGCTGACCGACCCCCGCCGCAGTACATACACCCCGGCTCACTAAACGTCGACGGCCTTTCGGTTTCCATCGCTCCTCAGCCTCTGGACCCTTATCAGCCTGGGGGATCTGTGGGCTTAGAGACTGGAATTGGATCGTTAGACTCTCGCTCGGTTGCTGGGCACACAACACAGAGCCTGCACCCCAGTGATAGTCACGAGCTGGACGCTGCGATTACTATGGGTAGTGTCTCCAGAGTTAACAGTCCCATCTCATCGGACGGCATTACAGAAGAGCTGAGCATGGAAGGAGTCGCAGCAGAGCACGGGCAGATCTCTAACGTCTCTCGCTCTCATGAGCCCCTCACTGTGGATGGGAGTCTACCCCCTGATGCTGGTGTGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATTACAGAATGAATGAGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829104
dbEST ID: 79646806
Trimmed Sequence: CGTGTGCGCGGTCAGGTGCCCGTCTGTGTTAAACACTGTGCTGTCCGAGCTCATTAACTCTTCATCCTCCGAATCCTCTTCCTCGTCCGTATCAGGTGTGAGGGGGGCAGTGCTTGGGCCCTTGCAGATCTTCAGGTGCCTGGTCAGGTGGTACCTGGTGAGGAAAGCCTTAAAGCATTTTTCGCACACGTAGTCCCGCCTCCCTTCGTGAGAATTGAGGTGATTCTTAAGGTGGCCTGTGCGGGAGAAGCATTTTTCACACTTGGGGCATTTGATCTGCCGTTCCCGAGTGTGGGTGAGCAAGTGTTGCTTCAGGTCCTGCCTTCGCATGAACATCTTCTTGCAGAAGTCGCATTTCAGGGTCTTCTCGCCCGTGTGTATGTCCATGTGGGAGGCCACGTGAGCTTTCTGGGTGAACGACTTGTCGCACAGGCCGCAGCGGTAATTCTTCTGCCCCGTGTGTATCCGGAGGTGGGTACGAAGGTTGCTGGGGTCGCTGAACGCCTTGTTGCAGAACTCGCATTTATGGGGTTTCATGCCCATGTGTCCCATGAAATGAACGTTGAGTTTTGAGGAGGAGCTGAGGGAGTGAGAGCACATTGAGCATTTCCACTTGCGCTCCTTGGTGAGTGTCAGCCCATTGGCCCCACTGCTCAGAGACTCGGCGGGGTAGGTGAAGTATTTATGGTGGCTCCTGGAAATCCTGCATACCAAATGGCACTTCCCTTC
Full Trace Sequence: CTGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGTGTGCGCGGTCAGGTGCCCGTCTGTGTTAAACACTGTGCTGTCCGAGCTCATTAACTCTTCATCCTCCGAATCCTCTTCCTCGTCCGTATCAGGTGTGAGGGGGGCAGTGCTTGGGCCCTTGCAGATCTTCAGGTGCCTGGTCAGGTGGTACCTGGTGAGGAAAGCCTTAAAGCATTTTTCGCACACGTAGTCCCGCCTCCCTTCGTGAGAATTGAGGTGATTCTTAAGGTGGCCTGTGCGGGAGAAGCATTTTTCACACTTGGGGCATTTGATCTGCCGTTCCCGAGTGTGGGTGAGCAAGTGTTGCTTCAGGTCCTGCCTTCGCATGAACATCTTCTTGCAGAAGTCGCATTTCAGGGTCTTCTCGCCCGTGTGTATGTCCATGTGGGAGGCCACGTGAGCTTTCTGGGTGAACGACTTGTCGCACAGGCCGCAGCGGTAATTCTTCTGCCCCGTGTGTATCCGGAGGTGGGTACGAAGGTTGCTGGGGTCGCTGAACGCCTTGTTGCAGAACTCGCATTTATGGGGTTTCATGCCCATGTGTCCCATGAAATGAACGTTGAGTTTTGAGGAGGAGCTGAGGGAGTGAGAGCACATTGAGCATTTCCACTTGCGCTCCTTGGTGAGTGTCAGCCCATTGGCCCCACTGCTCAGAGACTCGGCGGGGTAGGTGAAGTATTTATGGTGGCTCCTGGAAATCCTGCATACCAAATGGCACTTCCCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGTGTGCGCGGTCAGGT