ORFeome > prdx6 ORF1 – XORFeome v1.0

prdx6 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: prdx6
Gene ID: 6078052
Gene Page ID: 951730
ORF Xenbase ID: 17290713

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054309
Original XGC clone length: 675

Human orthology & disease relationships

NCBI Entrez ID: 9588
Ensembl gene IDs: ENSG00000117592
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103470,140350,155255,202370,203100,214100,238600,248600,254600,261500,266510,268000,268300,276710,300301,300584,601003,601539,605407,606952,608323,608643,609812

Library Location

Plate ID: GDExl11003
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ839556
dbEST ID: 79657258
Trimmed Sequence: ATGCCTGGAATCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGAACTGGCTGTACAACTTGGTATGCTTGACCCTGATGAGAAGGACATGCAGGGGATGCCAGTGACTGCAAGATGTGTTTTCATCATTGGCCCTGATAAGAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAAAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATTGGC
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGGAATCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGAACTGGCTGTACAACTTGGTATGCTTGACCCTGATGAGAAGGACATGCAGGGGATGCCAGTGACTGCAAGATGTGTTTTCATCATTGGCCCTGATAAGAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAAAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATTGGCCAACTTTCTTGTACAAAGTTGGCATTTATAGAAAGCATTGGCTTATCAATTTGGTTGCAACGAACAAGGTCACTATCCAGTCAAAATAAAAATCAATATTGGGCCTTCCAACCTGAAAAAACCAAAAAAAAAAGAAAAACAAAAAAATAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGGAATCCTGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839555
dbEST ID: 79657257
Trimmed Sequence: TTGTGGCTGTGCAGTGTATCTCAGGTATTTCTTTCCAGAAGGGAGCTCTTTGGTGAAGACGCCACATGTAAATATTTTACTTGCTTCTTCTTCAGGAACATTTGGGGGTACCATGACTCGATCACCCGGCTTCCAATCCACCGGAGTTGCAACATTATGAACTGCAGTCAGTTGAAGAGAATCCACAACTCTCAAAATTTCATCAAAATTTCTTCCAGTAGTGGCTGGATACAAAATAGAAAGCTTCATTTTCTTATCAGGGCCAATGATGAAAACACATCTTGCAGTCACTGGCATCCCCTGCATGTCCTTCTCATCAGGGTCAAGCATACCAAGTTGTACAGCCAGTTCCCTTTTGGGATCAGCAATAATAGGAAAGGGTAGTGTCTCTGTGGGCTCATCACAGTTATAAGAGTTGATGTCCTTGCTCCAGCCGAGATGATCCTCCACAGAGTCTATTGACAGGGCGATCATGGAAACATTGCGTTTTTTGAACTCCAGAGCCNGCTTTACACAACGTCCAAGCTCAGTGGTGCAGACAGGGGTATAATCCCGTGGGTGTGAAAAAAGGACACCCCATGAATTCCCGAGGAAATCGTGGAACCTGAATTCTGCCATGGTTGTGTCCGCCTCCGAGTTTAGAAAAAACGTCTCCCCACCAAGAATTCCAGGGAAGGGTGGCCCAACTTTTTTGTTCAAAATTTGGCCATTAAAAAAAAAGCAATTGGCCTCGTCCAATTTTTTTTTGCAACAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: CGTGAAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGTGGCTGTGCAGTGTATCTCAGGTATTTCTTTCCAGAAGGGAGCTCTTTGGTGAAGACGCCACATGTAAATATTTTACTTGCTTCTTCTTCAGGAACATTTGGGGGTACCATGACTCGATCACCCGGCTTCCAATCCACCGGAGTTGCAACATTATGAACTGCAGTCAGTTGAAGAGAATCCACAACTCTCAAAATTTCATCAAAATTTCTTCCAGTAGTGGCTGGATACAAAATAGAAAGCTTCATTTTCTTATCAGGGCCAATGATGAAAACACATCTTGCAGTCACTGGCATCCCCTGCATGTCCTTCTCATCAGGGTCAAGCATACCAAGTTGTACAGCCAGTTCCCTTTTGGGATCAGCAATAATAGGAAAGGGTAGTGTCTCTGTGGGCTCATCACAGTTATAAGAGTTGATGTCCTTGCTCCAGCCGAGATGATCCTCCACAGAGTCTATTGACAGGGCGATCATGGAAACATTGCGTTTTTTGAACTCCAGAGCCNGCTTTACACAACGTCCAAGCTCAGTGGTGCAGACAGGGGTATAATCCCGTGGGTGTGAAAAAAGGACACCCCATGAATTCCCGAGGAAATCGTGGAACCTGAATTCTGCCATGGTTGTGTCCGCCTCCGAGTTTAGAAAAAACGTCTCCCCACCAAGAATTCCAGGGAAGGGTGGCCCAACTTTTTTGTTCAAAATTTGGCCATTAAAAAAAAAGCAATTGGCCTCGTCCAATTTTTTTTTGCAACAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTGGCTGTGCAGTGTA