ORFeome > prf1 ORF1 – XORFeome v1.0

prf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prf1
Gene ID: 6254115
Gene Page ID: 5471042
ORF Xenbase ID: 17290755

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108842
Original XGC clone length: 1599

Human orthology & disease relationships

NCBI Entrez ID: 5551
Ensembl gene IDs: ENSG00000180644,LRG_94
Directly associated (OMIM) disease MIM numbers: 603553,605027
Indirectly associated (Lage, et al.) disease MIM numbers: 603553

Library Location

Plate ID: GDExl11083
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ837231
dbEST ID: 79654933
Trimmed Sequence: ATGCTCCATTTCTTCATGATCATCTGTTTCATCCCTTTGATATGTTCTTCCGCTCCCCTGCTTCACACCGTTACTTGTAAGCAAGGCACGAAGACACAATGTCTCAAGGCCTCCTTTGTACCAGGGCACAACCTCCCTGCAAGAGGAATAGATATAGTGACCATGAAGAGTGCTGGGAACATTCTGTTTAACACCCAGCAGTACATGAAAAATAACACTTGTAAATTGTGCCAAGATTCTCAAGATAAAGACAAATGGTGGAAATTACCTAGAGCCCTGGAGCAATGGAATATGCAAAGTTCCTGCAGAAGGACCATGGTGAGCAAAGTCTTACAATCTCCAGTCTTAGTGGCCAAGGAAGTGGCATCACGTGTGCAGAATGATTGGACAAATGATCTGAATTTGACATGCACAGAACTGCAAGGAAACGTAGCCATGGCTGGTGCCCAATCCAAAATGGTGCAGTTTGCTTTTGAGAAATTGCATTTGGACAAATATACTTTCCTCTCCCACAAGTTTGAATGTGAATATTACAGTTTTCAGATGTCTAGGCATTGGAACCTAAGTCCACATTTTTTGAAAGCTCTTGTCCAGCTCCCTAACTACTATAACTCCCGAAGCAACGTACAGTATCAACAACTGATAGCCTCGTATGGCACACACTATATCACTGATGCAACAAATGGGAGGGGCAAGTTGCAGGGAATTGACTGCATTTAAAAACCTGCAAAATTGGCTTTTGAATTAAAAGCCCAAATGCCAACCTGGTCGAAAGAATTGGCCCGAAAAACCAGAAAAAACAAATGAGCATTATTATTTGG
Full Trace Sequence: GGTGGCACCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTCCATTTCTTCATGATCATCTGTTTCATCCCTTTGATATGTTCTTCCGCTCCCCTGCTTCACACCGTTACTTGTAAGCAAGGCACGAAGACACAATGTCTCAAGGCCTCCTTTGTACCAGGGCACAACCTCCCTGCAAGAGGAATAGATATAGTGACCATGAAGAGTGCTGGGAACATTCTGTTTAACACCCAGCAGTACATGAAAAATAACACTTGTAAATTGTGCCAAGATTCTCAAGATAAAGACAAATGGTGGAAATTACCTAGAGCCCTGGAGCAATGGAATATGCAAAGTTCCTGCAGAAGGACCATGGTGAGCAAAGTCTTACAATCTCCAGTCTTAGTGGCCAAGGAAGTGGCATCACGTGTGCAGAATGATTGGACAAATGATCTGAATTTGACATGCACAGAACTGCAAGGAAACGTAGCCATGGCTGGTGCCCAATCCAAAATGGTGCAGTTTGCTTTTGAGAAATTGCATTTGGACAAATATACTTTCCTCTCCCACAAGTTTGAATGTGAATATTACAGTTTTCAGATGTCTAGGCATTGGAACCTAAGTCCACATTTTTTGAAAGCTCTTGTCCAGCTCCCTAACTACTATAACTCCCGAAGCAACGTACAGTATCAACAACTGATAGCCTCGTATGGCACACACTATATCACTGATGCAACAAATGGGAGGGGCAAGTTGCAGGGAATTGACTGCATTTAAAAACCTGCAAAATTGGCTTTTGAATTAAAAGCCCAAATGCCAACCTGGTCGAAAGAATTGGCCCGAAAAACCAGAAAAAACAAATGAGCATTATTATTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCCATTTCTTCATGATCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837230
dbEST ID: 79654932
Trimmed Sequence: TGGTGAACTGGGAATGTATTCATCACAATATTCACCTCCAAGATAAGGGGCACAGGTTGTGTAAAGGGTGTACACTAATTGCATATCACTGTATTGGCATGACATTTTATTATTCCCTGCTTTTAGAATTCCCTTACATGTTAAGAGTAGGTCATTATCTGTTGTAATGTCTTCATCCCACACCTCTATAGTGTACTTTTTCAGAGGGCCAAGCTCTACCATCCCAAAATCAAGTGTTTCATTCCACATAGGATCATCATTGTCAAATATAGTTTCAGTCTCTTTTTCATATCCATTGAAATAGAAGTTTACATAACTGTCTGTTGATGAGAAATAGTCTCCATTCAGACCCGTGGCAGATCTAATTTCAATGATTAACTTGGCTAATCCTTTTCTTGTTGGGCAGCAGTCTGAGTTGGTATATTTGGATGGGGAACAAGAACAACAGCAATCCTCCCTCTCGCTTGGATAGGTATTTCCTGAGCATGGACATTCTATCTTCGACGACCTCTTTTTGATGTATTTCCTGAAAGCAAGTCTTAGGCTTTCTCTCTTACGACTTCTGGAATTAAATAAAGGTATGAATGGGCATGAATGGATTATTTCGGTAGAAGAGGAAACCATCCTCATTACTCTCCAACCCGTAGGGTTCCCCTTTACAAACAAAAAAAAAAAATAAAACAATAGAAGATTTTCGCCTGCCTATCTGCCCCAAC
Full Trace Sequence: GGGAATCGGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGTGAACTGGGAATGTATTCATCACAATATTCACCTCCAAGATAAGGGGCACAGGTTGTGTAAAGGGTGTACACTAATTGCATATCACTGTATTGGCATGACATTTTATTATTCCCTGCTTTTAGAATTCCCTTACATGTTAAGAGTAGGTCATTATCTGTTGTAATGTCTTCATCCCACACCTCTATAGTGTACTTTTTCAGAGGGCCAAGCTCTACCATCCCAAAATCAAGTGTTTCATTCCACATAGGATCATCATTGTCAAATATAGTTTCAGTCTCTTTTTCATATCCATTGAAATAGAAGTTTACATAACTGTCTGTTGATGAGAAATAGTCTCCATTCAGACCCGTGGCAGATCTAATTTCAATGATTAACTTGGCTAATCCTTTTCTTGTTGGGCAGCAGTCTGAGTTGGTATATTTGGATGGGGAACAAGAACAACAGCAATCCTCCCTCTCGCTTGGATAGGTATTTCCTGAGCATGGACATTCTATCTTCGACGACCTCTTTTTGATGTATTTCCTGAAAGCAAGTCTTAGGCTTTCTCTCTTACGACTTCTGGAATTAAATAAAGGTATGAATGGGCATGAATGGATTATTTCGGTAGAAGAGGAAACCATCCTCATTACTCTCCAACCCGTAGGGTTCCCCTTTACAAACAAAAAAAAAAAATAAAACAATAGAAGATTTTCGCCTGCCTATCTGCCCCAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTGAACTGGGAATGTATTCATC