ORFeome > prkab2 ORF1 – XORFeome v1.0

prkab2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: prkab2
Gene ID: 976421
Gene Page ID: 976417
ORF Xenbase ID: 17290785

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053787
Original XGC clone length: 816

Human orthology & disease relationships

NCBI Entrez ID: 5565
Ensembl gene IDs: ENSG00000131791
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,125851,125853,175200,194050,194200,223000,235700,266200,312170,600858,602485,606777

Library Location

Plate ID: GDExl11002
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ839375
dbEST ID: 79657077
Trimmed Sequence: ATGGGTAACACTGCAAGTGATCGCATATCTGGAGATCGGCATGGCAAGTCCCACCGTGCAGATGGAGCAACTGCGGGACACTCTACAAAGGAGCATGAGGAAAACAAAATCATGGTTGGAAGCACAGACGACCCAAATATCTTTAGCACTCAAGAATCTAAGCACCCTGGAGACTCAACATGGACGCAGGACTCAGAGGATCCAGGGAAATCATCTCAGCAGGGTCGTCCCACTGTAATCCGTTGGACAGAAGGTGGCAAAGAAGTCTTCATATCTGGGTCATTCAACAACTGGAATACAAAAATTCCACTGATTAAAAGCCACAATGACTTTGTTGCCATTTTGGACCTTCCAGAGGGAGAGCATCAGTACAAGTTTTTTGTGGATGGGCAATGGGTACATGACCCTTCTGAGCCTGTGGTCACCAGCCAGCTTGGTACGATTAACAACTTAATCCATGTGAAGAAGTCAGATTTTGAAGTATTTGATGCTTTGAAACTGGATTCAATGGAAAGTTCTGACACGTCAGCTAGAGACTTGTCAAGTTCCCCCCCTGGACTTTATGGCCAAGAGTTATATGCCTACAAGCCAGAAGAACGCTTTAAATCACCTCCTATCCCTCCTCCCCATCTTCTGCAAGTTATTCTTAACAAGGATACCAACATCTCTTGCGATCCTGCGCTCCCTTCCAAAACCCAATCACGTCCATGCTAAACCACCCGTATGCTTTGTCAATAAAGGGAGGGGGTAATGGGTTCTAAGTGCGGACCCTTCCAATTTAAAAAAAAAAATAACGTCCCCCCCTTTTT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAACACTGCAAGTGATCGCATATCTGGAGATCGGCATGGCAAGTCCCACCGTGCAGATGGAGCAACTGCGGGACACTCTACAAAGGAGCATGAGGAAAACAAAATCATGGTTGGAAGCACAGACGACCCAAATATCTTTAGCACTCAAGAATCTAAGCACCCTGGAGACTCAACATGGACGCAGGACTCAGAGGATCCAGGGAAATCATCTCAGCAGGGTCGTCCCACTGTAATCCGTTGGACAGAAGGTGGCAAAGAAGTCTTCATATCTGGGTCATTCAACAACTGGAATACAAAAATTCCACTGATTAAAAGCCACAATGACTTTGTTGCCATTTTGGACCTTCCAGAGGGAGAGCATCAGTACAAGTTTTTTGTGGATGGGCAATGGGTACATGACCCTTCTGAGCCTGTGGTCACCAGCCAGCTTGGTACGATTAACAACTTAATCCATGTGAAGAAGTCAGATTTTGAAGTATTTGATGCTTTGAAACTGGATTCAATGGAAAGTTCTGACACGTCAGCTAGAGACTTGTCAAGTTCCCCCCCTGGACTTTATGGCCAAGAGTTATATGCCTACAAGCCAGAAGAACGCTTTAAATCACCTCCTATCCCTCCTCCCCATCTTCTGCAAGTTATTCTTAACAAGGATACCAACATCTCTTGCGATCCTGCGCTCCCTTCCAAAACCCAATCACGTCCATGCTAAACCACCCGTATGCTTTGTCAATAAAGGGAGGGGGTAATGGGTTCTAAGTGCGGACCCTTCCAATTTAAAAAAAAAAATAACGTCCCCCCCTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAACACTGCAAGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839374
dbEST ID: 79657076
Trimmed Sequence: AATTGGCTTGTACAATAAAGTGGTGACGTACTTCTTCTTATATCGATGGGTCGCACTAAGAACCATTACCCCATCCTTTATTGACAAAGCATACAGGTGGTTTAGCATGACGTGATTTGGTTCTGGAAGGAGCGCAGGATCGCAAGAGATGTTGGTATCCTTGTTAAGAATAACTTGCAGAAGATGGGGAGGAAGGATAGGAGGTGATTTAAAGCGTTCTTCTGGCTTGTAGGCATATAACTCTTGGCCATAAAGTCCAGGGGGGGAACTTGACAAGTCTCTAGCTGACGTGTCAGAACTTTCCATTGAATCCAGTTTCAAAGCATCAAATACTTCAAAATCTGACTTCTTCACATGGATTAAGTTGTTAATCGTACCAAGCTGGCTGGTGACCACAGGCTCAGAAGGGTCATGTACCCATTGCCCATCCACAAAAAACTTGTACTGATGCTCTCCCTCTGGAAGGTCCAAAATGGCAACAAAGTCATTGTGGCTTTTAATCAGTGGAATTTTTGTATTCCAGTTGTTGAATGACCCAGATATGAAGACTTCTTTGCCACCTTCTGTCCAACGGATTACAGTGGGACGAACCTGCTGAAAAGATTTCCCTGGAATCTCTGAGTCCTGCGTCCATGTTGAATCTCCCGGGTGGCTAAAATTCTTAATTCTAAGAAATTTTGGGTTTGTCTGGTGCTTTCCAACAATGAAATTTTGTTTTCCCCCTGGCTCCCTTTTGAAAAAAGGGTCCCCCGAAAT
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATTGGCTTGTACAATAAAGTGGTGACGTACTTCTTCTTATATCGATGGGTCGCACTAAGAACCATTACCCCATCCTTTATTGACAAAGCATACAGGTGGTTTAGCATGACGTGATTTGGTTCTGGAAGGAGCGCAGGATCGCAAGAGATGTTGGTATCCTTGTTAAGAATAACTTGCAGAAGATGGGGAGGAAGGATAGGAGGTGATTTAAAGCGTTCTTCTGGCTTGTAGGCATATAACTCTTGGCCATAAAGTCCAGGGGGGGAACTTGACAAGTCTCTAGCTGACGTGTCAGAACTTTCCATTGAATCCAGTTTCAAAGCATCAAATACTTCAAAATCTGACTTCTTCACATGGATTAAGTTGTTAATCGTACCAAGCTGGCTGGTGACCACAGGCTCAGAAGGGTCATGTACCCATTGCCCATCCACAAAAAACTTGTACTGATGCTCTCCCTCTGGAAGGTCCAAAATGGCAACAAAGTCATTGTGGCTTTTAATCAGTGGAATTTTTGTATTCCAGTTGTTGAATGACCCAGATATGAAGACTTCTTTGCCACCTTCTGTCCAACGGATTACAGTGGGACGAACCTGCTGAAAAGATTTCCCTGGAATCTCTGAGTCCTGCGTCCATGTTGAATCTCCCGGGTGGCTAAAATTCTTAATTCTAAGAAATTTTGGGTTTGTCTGGTGCTTTCCAACAATGAAATTTTGTTTTCCCCCTGGCTCCCTTTTGAAAAAAGGGTCCCCCGAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATTGGCTTGTACAATAAAGTGGT