ORFeome > prkacb ORF1 – XORFeome v1.0

prkacb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prkacb
Gene ID: 482706
Gene Page ID: 482701
ORF Xenbase ID: 17290791

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046697
Original XGC clone length: 1056

Human orthology & disease relationships

NCBI Entrez ID: 5567
Ensembl gene IDs: ENSG00000142875
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,102200,103580,104300,108500,117000,122880,124200,125853,132600,141500,145600,146510,148820,155255,160980,166350,170400,174200,174700,174800,175700,181450,183086,192605,193500,200990,204000,209950,232600,255960,261750,265120,268000,268220,275630,300071,306955,600274,600996,601005,601777,601887,602875,604772,606889,607624,607822,609637,609909

Library Location

Plate ID: GDExl11013
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ824074
dbEST ID: 79641776
Trimmed Sequence: ATGGGAAACGCTGCCACCGCCAAGAAGGGGAATGAAATTGAGAGCGTGAAAGAATTTCTAGCCAAAGCCAAAGAAGACTTTTTAAGAAAGTGGGAAACGCCTCCTCAGAATACTGCAAGTCTAGATGATTTTGATAGAATGAAAACCCTTGGAACTGGCTCATTTGGAAGAGTTATGTTAGTGAAACATAAAGGTGCAGAGCAGTATTATGCTATGAAGATACTGGATAAACAGAAGGTGGTGAAGCTGAAACAAATAGAGCATACATTAAATGAAAAGAGGATATTGCAGGCAGTGAACTTTCCTTTCCTTGTCAGGTTGGAATATTCCTTTAAGGATAACTCTAATTTATATATGATTATGGAATATGTCCCTGGGGGAGAAATGTTTTCACATTTAAGAAGGATTGGCAGGTTCAGTGAGCCTCACGCAAGATTTTACGCAGCTCAGATAGTGCTGACATTTGAGTACCTCCATTCACTAGACCTTATCTACAGAGATCTCAAACCAGAAAATCTTTTAATTGACCAGCAAGGATACATTCAGGTCACAGATTTTGGGTTTGCCAAAAGAGTAAAGGGCAGAACTTGGACATTATGTGGAACGCCAGAGTATCTGGCACCAGAAATTATTTTAAGCAAGGGTATAACAAAGCAGTTGACTGGTGGGCATTAGGAGTTTAATATATGAAATGGCTGCTGGGTATCCCCCTTTCTTGCTGATCAACCCATTCGATCTATTGAAAAAATGGGGTCGGGGAAAGGGTACGGGTTTCTTTCCCACCTTGCCCCATAAACCTTAAAAAAACGGGTTAGGGAAATTTGTCTCCC
Full Trace Sequence: TACTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAACGCTGCCACCGCCAAGAAGGGGAATGAAATTGAGAGCGTGAAAGAATTTCTAGCCAAAGCCAAAGAAGACTTTTTAAGAAAGTGGGAAACGCCTCCTCAGAATACTGCAAGTCTAGATGATTTTGATAGAATGAAAACCCTTGGAACTGGCTCATTTGGAAGAGTTATGTTAGTGAAACATAAAGGTGCAGAGCAGTATTATGCTATGAAGATACTGGATAAACAGAAGGTGGTGAAGCTGAAACAAATAGAGCATACATTAAATGAAAAGAGGATATTGCAGGCAGTGAACTTTCCTTTCCTTGTCAGGTTGGAATATTCCTTTAAGGATAACTCTAATTTATATATGATTATGGAATATGTCCCTGGGGGAGAAATGTTTTCACATTTAAGAAGGATTGGCAGGTTCAGTGAGCCTCACGCAAGATTTTACGCAGCTCAGATAGTGCTGACATTTGAGTACCTCCATTCACTAGACCTTATCTACAGAGATCTCAAACCAGAAAATCTTTTAATTGACCAGCAAGGATACATTCAGGTCACAGATTTTGGGTTTGCCAAAAGAGTAAAGGGCAGAACTTGGACATTATGTGGAACGCCAGAGTATCTGGCACCAGAAATTATTTTAAGCAAGGGTATAACAAAGCAGTTGACTGGTGGGCATTAGGAGTTTAATATATGAAATGGCTGCTGGGTATCCCCCTTTCTTGCTGATCAACCCATTCGATCTATTGAAAAAATGGGGTCGGGGAAAGGGTACGGGTTTCTTTCCCACCTTGCCCCATAAACCTTAAAAAAACGGGTTAGGGAAATTTGTCTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAACGCTGCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829382
dbEST ID: 79647084
Trimmed Sequence: AAAGTCGGCAAACTCTTTTGCACATTTTTCTGTCAGAGACACACGAATATCTTCTTCTTCATAGTCATCAAAGTTACTGGTATCTCCAGGCCCTCTGCACTTTGGTATGAAGGGAGCTTCCACCTTTCTCTGATAAATTGCAATCCAGTCTGTTGTAGCAAACCATTTGTGATTTTTGATGTCATTAACGCCATTCTTCAAGTTGCCATATCTTTTGGTCAAATCTACCTGGAGCAAGTTCCTTAGCAGGTCTTTAAGGTCTGAGCTGAAGTGGGAAGGAAACCGTACCTTTCCTGACACAATTTTTTCATAGATCTGAATGGGTTGATCAGCAAAGAAAGGGGGATAACCAGCAGCCATTTCATATATTAAAACTCCTAATGCCCACCAGTCAACTGCTTTGTTATAACCCTTGCTTAAAATAATTTCTGGTGCCAGATACTCTGGCGTTCCACATAATGTCCAAGTTCTGCCCTTTACTCTTTTGGCAAACCCAAAATCTGTGACCTGAATGTATCCTTGCTGGTCAATTAAAAGATTTTCTGGTTTGAGATCTCTGTAGATAAGGTCTAGTGAATGGAGGTACTCAAATGTCAGCACTATCTGAGCTGCGTAGAATCTTGCGTGAGGCTCACTGAACCTGCCAATCCTTCTTAAATGTGAAAACATTTCTTCCCCAAGGACATATTCCATAAACCAAATTATAATTAAAAATTATCCCTAAAAGGGAATATTCCCAACCTGGAAAAGGGAAAGGGAAAGGTTTCACGGC
Full Trace Sequence: GGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTCGGCAAACTCTTTTGCACATTTTTCTGTCAGAGACACACGAATATCTTCTTCTTCATAGTCATCAAAGTTACTGGTATCTCCAGGCCCTCTGCACTTTGGTATGAAGGGAGCTTCCACCTTTCTCTGATAAATTGCAATCCAGTCTGTTGTAGCAAACCATTTGTGATTTTTGATGTCATTAACGCCATTCTTCAAGTTGCCATATCTTTTGGTCAAATCTACCTGGAGCAAGTTCCTTAGCAGGTCTTTAAGGTCTGAGCTGAAGTGGGAAGGAAACCGTACCTTTCCTGACACAATTTTTTCATAGATCTGAATGGGTTGATCAGCAAAGAAAGGGGGATAACCAGCAGCCATTTCATATATTAAAACTCCTAATGCCCACCAGTCAACTGCTTTGTTATAACCCTTGCTTAAAATAATTTCTGGTGCCAGATACTCTGGCGTTCCACATAATGTCCAAGTTCTGCCCTTTACTCTTTTGGCAAACCCAAAATCTGTGACCTGAATGTATCCTTGCTGGTCAATTAAAAGATTTTCTGGTTTGAGATCTCTGTAGATAAGGTCTAGTGAATGGAGGTACTCAAATGTCAGCACTATCTGAGCTGCGTAGAATCTTGCGTGAGGCTCACTGAACCTGCCAATCCTTCTTAAATGTGAAAACATTTCTTCCCCAAGGACATATTCCATAAACCAAATTATAATTAAAAATTATCCCTAAAAGGGAATATTCCCAACCTGGAAAAGGGAAAGGGAAAGGTTTCACGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTCGGCAAACTCTTTTGCAC