ORFeome > prkag1 ORF1 – XORFeome v1.0

prkag1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prkag1
Gene ID: 1010729
Gene Page ID: 1010725
ORF Xenbase ID: 17290803

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060444
Original XGC clone length: 1677

Human orthology & disease relationships

NCBI Entrez ID: 5571
Ensembl gene IDs: ENSG00000181929
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,125851,125853,175200,194200,223000,235700,266200,312170,600858,602485,606777

Library Location

Plate ID: GDExl11021
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ824813
dbEST ID: 79642515
Trimmed Sequence: ATGGGAAGTACAGTCATGGACACCAAGAAGAAAAAGGATCTGCCCAGGAAGCCCTCCAGCCAGAAGAAGAAGATGCTGAGAGTCCACATCCCTGACCTCAGTTCCTTTGCTATGCCGTTTTTGGATGGAGATTTGGATAATGCAGAGAAAAATTCCCAGCGCAAGGCAGAGGAGCCTTGTAGTACTGGAAGCCCATCCAAAAGCTTTTACCCCCGAAGCCTCCAAAACCAGCCATCGAGTCCGGTATCTGCCCCGGTCAAAATGAAGTGCAGCCCCGGATCTCCCAAGACCGTCTTTCCCTTCCCAAATCAGGAGTCCCCCCCTCGCTCCCCCCGTCGGATGAGCTTCAGCGGCATCTTCAGATCTTCCTCCAAAGATTCTTCTTCTCCCAACTCCAACCCGTCTACCTCACCTGGCGGAATCCGATTCTTCACAAGATCGAGGAAAACTTCAGGACTCTCCTCCTCCCCATCCACTCCCACACAAGTGACCAAGCAGCCCATCTTCCCCCTTGAATCCTACAAACATGAGCCAGAACGGTTAGAGGCCAGACTGCGCTCTTACTCCTCACCTCCAGACACTGGACAGAGGTTTTCATTACCTCACTTGCCCATAACTGTGACAAAGTCCTCAGTCGTGTCATCATCCCTCAGCGCTACCTCAAGAACAGCTCANAGCACCACTGAAGGCATGCTGGAGAAACTAGAGCTGGAGGATGAAGCTGTTGAAGAATCCGAGAGTGACATATATACGCGCTTCATGAAAATCACACAAGTGCCTACGACATTGGTCCCGACCAACCTTCAAAACCTGGTTGGAAATTCCA
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAGTACAGTCATGGACACCAAGAAGAAAAAGGATCTGCCCAGGAAGCCCTCCAGCCAGAAGAAGAAGATGCTGAGAGTCCACATCCCTGACCTCAGTTCCTTTGCTATGCCGTTTTTGGATGGAGATTTGGATAATGCAGAGAAAAATTCCCAGCGCAAGGCAGAGGAGCCTTGTAGTACTGGAAGCCCATCCAAAAGCTTTTACCCCCGAAGCCTCCAAAACCAGCCATCGAGTCCGGTATCTGCCCCGGTCAAAATGAAGTGCAGCCCCGGATCTCCCAAGACCGTCTTTCCCTTCCCAAATCAGGAGTCCCCCCCTCGCTCCCCCCGTCGGATGAGCTTCAGCGGCATCTTCAGATCTTCCTCCAAAGATTCTTCTTCTCCCAACTCCAACCCGTCTACCTCACCTGGCGGAATCCGATTCTTCACAAGATCGAGGAAAACTTCAGGACTCTCCTCCTCCCCATCCACTCCCACACAAGTGACCAAGCAGCCCATCTTCCCCCTTGAATCCTACAAACATGAGCCAGAACGGTTAGAGGCCAGACTGCGCTCTTACTCCTCACCTCCAGACACTGGACAGAGGTTTTCATTACCTCACTTGCCCATAACTGTGACAAAGTCCTCAGTCGTGTCATCATCCCTCAGCGCTACCTCAAGAACAGCTCANAGCACCACTGAAGGCATGCTGGAGAAACTAGAGCTGGAGGATGAAGCTGTTGAAGAATCCGAGAGTGACATATATACGCGCTTCATGAAAATCACACAAGTGCCTACGACATTGGTCCCGACCAACCTTCAAAACCTGGTTGGAAATTCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAGTACAGTCATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ830184
dbEST ID: 79647886
Trimmed Sequence: TTCTGCTTCACTCTCCTTCCTTTTGGCACCTGCTGGGGAAAGCACTAAGGCCTGTAGAATGTCTGAGAGAGAGATAATTCCCACAATGCTGTCTGCTTCATCTACGACTACCAGTCTGTGCACCTCTGCCTTAACTATCCGATCCACAATTGTCTCCAGTGTCTCCGGCTTACTGCACTTCACCACTCCTTCGAAATACTGCGATCGGTGTTCGAGGGCCTGCGTCACTGTGATATCCAGATTGTTGTAGGTTTTCTCAGCAGCGAGGTTAATGACATCAAATTTGGAATAAATATCTACGACTTTTCCAGACTCGTCCACCACTGGTAACGCCGAGACTCTTCTCTCCACGAATATATTCAAAGCTTTAATAATAGGAGTGTGGGGCTGAATGAAGGCAATGTTGTGGTATGTGCCGATCCCAAGCTCCTCTAAATTCTGTTTCATGAAGGCAGGCTTTGGCATTTCTGACACAAAAAGCTGAAGGAACTTGAGGATTCTTTTGTGAGTAAGTATATAAAGTGCATTTCCACTGACTGGGTCAATAACAGGCAATCTGTGGATTTTATTTTTTTATCATGAATACACGGCATCGAAGAGACTTGCATCTGGAAAAATGTTCACTAGAGGCTTGAACGTCTCCTGTAAATACAGCTCCCTTCCAAGTCTCAATCTTGTGCTCTTCTAGCTCATAAATCTGTTACCATTGGGAAACTTTGTAATATTCCATGCCAAAATATTAAAAGGAAAAACCGGGTAAAT
Full Trace Sequence: GGCAGAGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTGCTTCACTCTCCTTCCTTTTGGCACCTGCTGGGGAAAGCACTAAGGCCTGTAGAATGTCTGAGAGAGAGATAATTCCCACAATGCTGTCTGCTTCATCTACGACTACCAGTCTGTGCACCTCTGCCTTAACTATCCGATCCACAATTGTCTCCAGTGTCTCCGGCTTACTGCACTTCACCACTCCTTCGAAATACTGCGATCGGTGTTCGAGGGCCTGCGTCACTGTGATATCCAGATTGTTGTAGGTTTTCTCAGCAGCGAGGTTAATGACATCAAATTTGGAATAAATATCTACGACTTTTCCAGACTCGTCCACCACTGGTAACGCCGAGACTCTTCTCTCCACGAATATATTCAAAGCTTTAATAATAGGAGTGTGGGGCTGAATGAAGGCAATGTTGTGGTATGTGCCGATCCCAAGCTCCTCTAAATTCTGTTTCATGAAGGCAGGCTTTGGCATTTCTGACACAAAAAGCTGAAGGAACTTGAGGATTCTTTTGTGAGTAAGTATATAAAGTGCATTTCCACTGACTGGGTCAATAACAGGCAATCTGTGGATTTTATTTTTTTATCATGAATACACGGCATCGAAGAGACTTGCATCTGGAAAAATGTTCACTAGAGGCTTGAACGTCTCCTGTAAATACAGCTCCCTTCCAAGTCTCAATCTTGTGCTCTTCTAGCTCATAAATCTGTTACCATTGGGAAACTTTGTAATATTCCATGCCAAAATATTAAAAGGAAAAACCGGGTAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGCTTCACTCTCCTTCCT