ORFeome > prmt1 ORF1 – XORFeome v1.0

prmt1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: prmt1
Gene ID: 6254417
Gene Page ID: 484021
ORF Xenbase ID: 17290887

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC054955
Original XGC clone length: 1032

Human orthology & disease relationships

NCBI Entrez ID: 3276
Ensembl gene IDs: ENSG00000126457
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,113800,123400,124200,133239,137440,142680,144200,146590,151623,180849,194050,201475,203100,209950,211980,212065,214150,216400,228600,235800,236490,242860,250940,260500,275355,600962,601675,601859,603218,605850,606952,607271,607602,607654,607822,608643

Library Location

Plate ID: GDExl11001
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ839058
dbEST ID: 79656760
Trimmed Sequence: ATGGAGGTTAATAGTGCTCCACCTGAGGGCGGTGTGAAAACAAATGCAGAAGACATGACATCAAAAGATTACTACTTTGACTCCTATGCTCACTTTGGCATCCATGAGGAGATGCTAAAAGATGAAGTTCGGACACTGACCTACCGTAACTCAATGTTTCACAACAGACACCTGTTTAAAGACAAAGTTGTCTTGGATGTTGGGAGTGGCACGGGTATTCTCTGCATGTTTGCAGCAAAGGCCGGAGCCAAGAAAGTAATTGGGATTGAGTGCTCAAGTATATCTGACTACGCCATAAAAATCGTGAAGGCAAATAAACTAGATCACGTGGTCACCATCATCAAAGGCAAAGTAGAAGAGGTGGAGCTCCCAGTAGAAAAAGTGGACATCATAATCAGTGAATGGATGGGATATTGTCTATTCTATGAATCAATGCTTAACACTGTTATCTATGCACGTGATAAATGGCTGACTCCAGATGGATTAATATTTCCAGATCGCGCTACACTGTATATAACAGCTATTGAGGATAGACAATACAAAGACTACAAGATTCACTGGTGGGAAAATGTTTATGGCTTTGATATGTCTTGCATTAAGGATGTAGCCATCAAGGAGCCTCTGGTTGATGTTGTTGACCCCAAGCAACTGGTCCCAAACGCTTGCCTTATAAAGGAAGTTGATATTTATACTGGTCAAAATGGATGAATTTGAGTTTTACCTCTCCATTTCTCCTGCCAGGTGAAACGAAAAAGAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTAATAGTGCTCCACCTGAGGGCGGTGTGAAAACAAATGCAGAAGACATGACATCAAAAGATTACTACTTTGACTCCTATGCTCACTTTGGCATCCATGAGGAGATGCTAAAAGATGAAGTTCGGACACTGACCTACCGTAACTCAATGTTTCACAACAGACACCTGTTTAAAGACAAAGTTGTCTTGGATGTTGGGAGTGGCACGGGTATTCTCTGCATGTTTGCAGCAAAGGCCGGAGCCAAGAAAGTAATTGGGATTGAGTGCTCAAGTATATCTGACTACGCCATAAAAATCGTGAAGGCAAATAAACTAGATCACGTGGTCACCATCATCAAAGGCAAAGTAGAAGAGGTGGAGCTCCCAGTAGAAAAAGTGGACATCATAATCAGTGAATGGATGGGATATTGTCTATTCTATGAATCAATGCTTAACACTGTTATCTATGCACGTGATAAATGGCTGACTCCAGATGGATTAATATTTCCAGATCGCGCTACACTGTATATAACAGCTATTGAGGATAGACAATACAAAGACTACAAGATTCACTGGTGGGAAAATGTTTATGGCTTTGATATGTCTTGCATTAAGGATGTAGCCATCAAGGAGCCTCTGGTTGATGTTGTTGACCCCAAGCAACTGGTCCCAAACGCTTGCCTTATAAAGGAAGTTGATATTTATACTGGTCAAAATGGATGAATTTGAGTTTTACCTCTCCATTTCTCCTGCCAGGTGAAACGAAAAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTAATAGTGCTCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839057
dbEST ID: 79656759
Trimmed Sequence: ACGCATTCTGTAGTCTGTTGAACACGACAACTCACACAACTGGCCCTTGAAGTCAATGTCAAAGGTAAAATCCAGGTCACGATTGTTTTTGGCATTGGGCTTCATGCCGATGGTACCAAAGATCTCCTCGCCAGTCTTAACAGTGAGATAATCTTCCATGTAGAAGACAGTTTGCTTCCAGTGAGTGTATGGAGACTCTGGACTTGTAGAGAAGCCAGTTCTTTTATGGCAGCGGGTGAATTCAATGTTGAAATATGCAACCAGGGCATGGATGTAGTCATTTCGTTTCACTTGCAGGCAGAATGGAGAGGTAAAACTCAAGTCATCCACTTTGACAGTATAAATATCAACTTCCTTTATAAGGCAAGCGTTTGAGACCAGTTGCTTGGGGTCAACAACATCAACCAGAGGCTCCTTGATGGCTACATCCTTAATGCAAGACATATCAAAGCCATAAACATTTTCCCACCAGTGAATCTTGTAGTCTTTGTATTGTCTATCCTCAATAGCTGTTATATACAGTGTAGCGCGATCTGGAAATATTAATCCATCTGGAGTCAGCCATTTAACCACGTGCAAAGATAACAAGTGTTAAGCATTGATTCATAAAAATAAAACAATATCCCAATCCTTTCACTGAATAAGAATGTCCACTTTTTTCCACTGGGGAACCTCCCCCCCTTCCTACCTTTTGCCTTTTGAAGGAAGGGGGAACCACAGTGAATCCAAATTTTAATTTTTCCCCTTTC
Full Trace Sequence: GCCGGGCAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGCATTCTGTAGTCTGTTGAACACGACAACTCACACAACTGGCCCTTGAAGTCAATGTCAAAGGTAAAATCCAGGTCACGATTGTTTTTGGCATTGGGCTTCATGCCGATGGTACCAAAGATCTCCTCGCCAGTCTTAACAGTGAGATAATCTTCCATGTAGAAGACAGTTTGCTTCCAGTGAGTGTATGGAGACTCTGGACTTGTAGAGAAGCCAGTTCTTTTATGGCAGCGGGTGAATTCAATGTTGAAATATGCAACCAGGGCATGGATGTAGTCATTTCGTTTCACTTGCAGGCAGAATGGAGAGGTAAAACTCAAGTCATCCACTTTGACAGTATAAATATCAACTTCCTTTATAAGGCAAGCGTTTGAGACCAGTTGCTTGGGGTCAACAACATCAACCAGAGGCTCCTTGATGGCTACATCCTTAATGCAAGACATATCAAAGCCATAAACATTTTCCCACCAGTGAATCTTGTAGTCTTTGTATTGTCTATCCTCAATAGCTGTTATATACAGTGTAGCGCGATCTGGAAATATTAATCCATCTGGAGTCAGCCATTTAACCACGTGCAAAGATAACAAGTGTTAAGCATTGATTCATAAAAATAAAACAATATCCCAATCCTTTCACTGAATAAGAATGTCCACTTTTTTCCACTGGGGAACCTCCCCCCCTTCCTACCTTTTGCCTTTTGAAGGAAGGGGGAACCACAGTGAATCCAAATTTTAATTTTTCCCCTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGCATTCTGTAGTCTGTTG