ORFeome > prmt10 ORF1 – XORFeome v1.0

prmt10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prmt10
Gene ID: 5998467
Gene Page ID: 5998443
ORF Xenbase ID: 17290905

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126010
Original XGC clone length: 2484

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ837340
dbEST ID: 79655042
Trimmed Sequence: ATGGCAGGCCAGGCTGCTAGCAAGAGACGCCTGATTTCCAGATCTCTGCAGAGTGCTGACATCTGCCTGCAGCATCAGGACTATGGCACTGCCTATGCCCACCTTCTACTGGTGCTTACTCTGGCTCCTGAGCAAAAGGAAGCCTTAAAGGAAATGTTTCAATATTCTTTATTTAAATGGGCGGAAGAGCTGTATGCTTTGAATCGCAGTCAAGATTTATTCAATTGTTATGAGCAAGCGCTAGAACTGTTTCCAATCGATGATGTCATTTGTAATAGTATGGGTGAACATCTCTTCAGACTGGGCTTCCGAGATGAAGCTGCTGGTTATTTCTACAAGGCACTGAAGCTTAACCCAAGCTCTGCTGAGGCCAAGGAAAACTTCTACCGTGTAGCAAACTGGTTAATAGAGCGCTGGCATTTTATCATGCTCAATGACACTAAGAGAAACCTGATGTATAGGGCAGCTATCCAAAATGCCATACAGAATGGTTGCAAAACTGTACTTGATATTGGAACTGGCACTGGAATTTTAAGTATGTTTGCTAAAAAAGCTGGAGCACCATTTGTTTATGCTTGTGAGCTATCCAAAACTATGTATGAGCTTGCTTGTGAAATAGTGACTGCCAATCAAATGGATGGACATATCAAGCTGTTGCACATGAAGTCCCATGATATTCNAATCCAGAACACATCCCTGAAAGGTTTCCCTGGTGTTACAGAGACGTTTGATGCAAGTTTGTTTGGTGGAAGGGGTAATTTTGGAAACCCTAATTCCTGGCTTGGAAAAAACCCACTTTTTCCGCCCAACCCCAAAAAAATTGGGTGGGT
Full Trace Sequence: GGGGGGCCCATATAAGTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGCCAGGCTGCTAGCAAGAGACGCCTGATTTCCAGATCTCTGCAGAGTGCTGACATCTGCCTGCAGCATCAGGACTATGGCACTGCCTATGCCCACCTTCTACTGGTGCTTACTCTGGCTCCTGAGCAAAAGGAAGCCTTAAAGGAAATGTTTCAATATTCTTTATTTAAATGGGCGGAAGAGCTGTATGCTTTGAATCGCAGTCAAGATTTATTCAATTGTTATGAGCAAGCGCTAGAACTGTTTCCAATCGATGATGTCATTTGTAATAGTATGGGTGAACATCTCTTCAGACTGGGCTTCCGAGATGAAGCTGCTGGTTATTTCTACAAGGCACTGAAGCTTAACCCAAGCTCTGCTGAGGCCAAGGAAAACTTCTACCGTGTAGCAAACTGGTTAATAGAGCGCTGGCATTTTATCATGCTCAATGACACTAAGAGAAACCTGATGTATAGGGCAGCTATCCAAAATGCCATACAGAATGGTTGCAAAACTGTACTTGATATTGGAACTGGCACTGGAATTTTAAGTATGTTTGCTAAAAAAGCTGGAGCACCATTTGTTTATGCTTGTGAGCTATCCAAAACTATGTATGAGCTTGCTTGTGAAATAGTGACTGCCAATCAAATGGATGGACATATCAAGCTGTTGCACATGAAGTCCCATGATATTCNAATCCAGAACACATCCCTGAAAGGTTTCCCTGGTGTTACAGAGACGTTTGATGCAAGTTTGTTTGGTGGAAGGGGTAATTTTGGAAACCCTAATTCCTGGCTTGGAAAAAACCCACTTTTTCCGCCCAACCCCAAAAAAATTGGGTGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGCCAGGCTGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ837339
dbEST ID: 79655041
Trimmed Sequence: CTGCAGTGGTCTTGTTAGTTTCATGCTCATACTGCTGTTCTGGAACTGAACCTCAAGCAAGAGCTCCTCCCCTTCCAGCACACATGTAGGGGTCTCCAGCACATACGCCGCCTGTTTCCAATGTGATGCCTCACTGGACGTGTCTAGGCTAATGGCTTCATCAATGTGTATGTGGTACCAGAATGTAACGGCTGTAACCTGGCCAGATCTACAGATATTCACCTTGATTCTCATTACAGAGCTGCTCTGATTGTTTGAACAGGGATTCATTAGATCCAGCCTTAGCAGTTCAAACTGTTCACTTAAGGGTATACAGGGGACAGTAGAGAGGTTCAAAAACACATGGGCAGGAACCTTGAATCGATTTATAAAAGGTGCTATAAGGAAGCCTAGAGTAGGTTCGTTGCCTTGGACTGAGCCCTCATGCAGTAACGTCTTTGATTCTATCAGCATCCCTTGCATTACCACTGCATGGGGGAATATCTTGCCTCCTGGCTCTAGTAAACACCTGGCTATTGCAGCTTTCTCTAATAAATCTTGTCGAATCAGACCACAGGTCTCAATCACATCAAGAATTATGATGCTCCACATCTTGTCAGACTTTTGGCTTCTGTGCGGCACCGTCATCTGTTTCTAGTTGGCTCAAACAAATTCCCGGGACTCATTATTATTAAAATCATAATCCCAAAACAATTCCCAAAAACCCCTCGTGGGTGCCTCCTTTCTCCACGGGACCTAAAGGCATTCCACCTTTTCCCACCCTTTCCCCCCC
Full Trace Sequence: AAACCTGCTATTGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCAGTGGTCTTGTTAGTTTCATGCTCATACTGCTGTTCTGGAACTGAACCTCAAGCAAGAGCTCCTCCCCTTCCAGCACACATGTAGGGGTCTCCAGCACATACGCCGCCTGTTTCCAATGTGATGCCTCACTGGACGTGTCTAGGCTAATGGCTTCATCAATGTGTATGTGGTACCAGAATGTAACGGCTGTAACCTGGCCAGATCTACAGATATTCACCTTGATTCTCATTACAGAGCTGCTCTGATTGTTTGAACAGGGATTCATTAGATCCAGCCTTAGCAGTTCAAACTGTTCACTTAAGGGTATACAGGGGACAGTAGAGAGGTTCAAAAACACATGGGCAGGAACCTTGAATCGATTTATAAAAGGTGCTATAAGGAAGCCTAGAGTAGGTTCGTTGCCTTGGACTGAGCCCTCATGCAGTAACGTCTTTGATTCTATCAGCATCCCTTGCATTACCACTGCATGGGGGAATATCTTGCCTCCTGGCTCTAGTAAACACCTGGCTATTGCAGCTTTCTCTAATAAATCTTGTCGAATCAGACCACAGGTCTCAATCACATCAAGAATTATGATGCTCCACATCTTGTCAGACTTTTGGCTTCTGTGCGGCACCGTCATCTGTTTCTAGTTGGCTCAAACAAATTCCCGGGACTCATTATTATTAAAATCATAATCCCAAAACAATTCCCAAAAACCCCTCGTGGGTGCCTCCTTTCTCCACGGGACCTAAAGGCATTCCACCTTTTCCCACCCTTTCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCAGTGGTCTTGTTAGT