ORFeome > prmt3 ORF1 – XORFeome v1.0

prmt3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prmt3
Gene ID: 946968
Gene Page ID: 946962
ORF Xenbase ID: 17290911

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123235
Original XGC clone length: 1560

Human orthology & disease relationships

NCBI Entrez ID: 10196
Ensembl gene IDs: ENSG00000185238
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,203100,212065,235800,242860,250940,605850,606952,608643

Library Location

Plate ID: GDExl11089
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ838257
dbEST ID: 79655959
Trimmed Sequence: ATGGGATGCGCAGATTTGGAACCTTATACCATAAAGAACATCGACTGTCAGACAACAACCATCAAGGATTTAGATTTTGCTTCGGATTTCTCACTGAGCGTAACCAGGGATGCGTCTTGCACGGCACTCGGTGGTTACTTTGACGTTTCCTTTGAGAAGAACTGCCAGAGAGTGGTTTCCTTCTCCACAAGCCCCTCATGTGCCAAAACGCACTGGAAACAGACTGTTTTTCTGCTGGAGAAACCCATCCCTGCCAAAGCCGGGGACATGTTGAAAGGCAGAATAACTGTGCGCAAGAACCGGAAGGATCCGCGCTCCCTCATTATTACACTTCTATTAAATGGCATTACCCAGACTTACGCCCTCCAGTT
Full Trace Sequence: TCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATGCGCAGATTTGGAACCTTATACCATAAAGAACATCGACTGTCAGACAACAACCATCAAGGATTTAGATTTTGCTTCGGATTTCTCACTGAGCGTAACCAGGGATGCGTCTTGCACGGCACTCGGTGGTTACTTTGACGTTTCCTTTGAGAAGAACTGCCAGAGAGTGGTTTCCTTCTCCACAAGCCCCTCATGTGCCAAAACGCACTGGAAACAGACTGTTTTTCTGCTGGAGAAACCCATCCCTGCCAAAGCCGGGGACATGTTGAAAGGCAGAATAACTGTGCGCAAGAACCGGAAGGATCCGCGCTCCCTCATTATTACACTTCTATTAAATGGCATTACCCAGACTTACGCCCTCCAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAAAAAAAGTACAAAATCAATTATGTTACACTCGCGGTGCCCCCGCCGGGCGAAAAAACAAAGTCTCACAAAAAAAAAACGCGGGGTTTATTTTTTTGTTTGTGAGGGGGAGCGGGGGAAGCCCCGGGAGAAAACGGGGGTGTGGTTTTTATTTTGTGGGGTAAGGGGGGGGGGGGGGGGGGGGCGGCCAACAAAGGGGGAGAGAAAAGAGGGGGGGGGGCGACGCCCGCTGGGGGTTTTTTTTATTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTATTTTATTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATGCGCAGATTTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838256
dbEST ID: 79655958
Trimmed Sequence: CTGGAGGGCGTAAGTCTGGGTAATGCCATTTAATAGAAGTGTAATAATGAGGGAGCGCGGATCCTTCCGGTTCTTGCGCACAGTTATTCTGCCTTTCAACATGTCCCCGGCTTTGGCAGGGATGGGTTTCTCCAGCAGAAAAACAGTCTGTTTCCAGTGCGTTTTGGCACATGAGGGGCTTGTGGAGAAGGAAACCACTCTCTGGCAGTTCTTCTCAAAGGAAACGTCAAAGTAACCACCGAGTGCCGTGCAAGACGCATCCCTGGTTACGCTCAGTGAGAAATCCGAAGCAAAATCTAAATCCTTGATGGTTGTTGTCTGACAGTCGATGTTCTTTATGGTATAAGGTTCCAAATCTGCGCATCCCATGG
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGAGGGCGTAAGTCTGGGTAATGCCATTTAATAGAAGTGTAATAATGAGGGAGCGCGGATCCTTCCGGTTCTTGCGCACAGTTATTCTGCCTTTCAACATGTCCCCGGCTTTGGCAGGGATGGGTTTCTCCAGCAGAAAAACAGTCTGTTTCCAGTGCGTTTTGGCACATGAGGGGCTTGTGGAGAAGGAAACCACTCTCTGGCAGTTCTTCTCAAAGGAAACGTCAAAGTAACCACCGAGTGCCGTGCAAGACGCATCCCTGGTTACGCTCAGTGAGAAATCCGAAGCAAAATCTAAATCCTTGATGGTTGTTGTCTGACAGTCGATGTTCTTTATGGTATAAGGTTCCAAATCTGCGCATCCCATGGTGCCAACTTTTTTGTACAAAATTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCCTTTNAAAAAAAAAAGGATAACAAAAAATAGACTGGGTCGGGGAGACCGCCGGGAAAAAAAAANAAAAAAATCAAAAAAAAAAAAAGATCTTGGTGATACTCCCTTTTGGTAGGAGAAGGGACCACCACCGCGCGGACAACACACCGGGCGCGTTGGGGTGTGGGGGGAAAAGAGGGGGGGGGGCTTGTTGNNGTTNTCNTGAAATTATTAAAAAGAAAGANGGGGGNTACCGNAGGAAAAGAAGNATATTNNTGTTTTTGTTGGGGGGGGTTNTTTTTTTTTNTANNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGAGGGCGTAAGTCTGGGT