ORFeome > prmt5 ORF1 – XORFeome v1.0

prmt5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prmt5
Gene ID: 975037
Gene Page ID: 975033
ORF Xenbase ID: 17290917

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108761
Original XGC clone length: 1902

Human orthology & disease relationships

NCBI Entrez ID: 10419
Ensembl gene IDs: ENSG00000100462
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,203100,212065,214150,216400,235800,242860,250940,601675,605850,606952,608643

Library Location

Plate ID: GDExl11085
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCAGGCGGTGGACCCCTTGTGACTGCCTCCCTCAAACCTGCATACCTGACTGAACGCTCATAAACAGTGTATGCCGTAGAAAAAAATCCCAATGCAGTGATAACGTTAGAAGGCTGGCCTTATGAGCGAATGGGGCAATCTTGTGACTGTGGTGTCTGGTGACATGACAGAATGAAAGGCACCTGAAAACGCGGAGATTACAGTTAGAGAGCTTCTGGGATCAATTGGGGATAATGAGCTGTATCCTGAATGTCTGGATGGAGCCCAGCACTTCCTGAAAGAAGATGGAGATACTATTCCCCGTGAATACACTTCTTTCTTGGCGCCTATATCGTCATCCACACTGTATAATGATGTACGGCCTTGCAAGGAAAAAGACATATACCCCCACCCTCAATTTGAGATGCCATATGTACTGATTCTACACAACTTCCATCAGATATCACATCCCTTGCCATGCTTCACATTCCACCATCACATCATAGATGCTGACCTTGATAATACCCGCTACTGTTACCTGCACTACAGAGTGGACATAAACACAATGCTACATGGGTTTGCTGGATATTTCAACTCTGTGTTGTACATAGATGTGACACTGAATATTTGCCCTGAAACTTCCTCTCCGGGCATGTTTTCTTGGTTTCCCATCATCTTTTCTATCAACCAACCAACTTCCTTTCCGGAAGGTTCAAAATGTTTTGTTTACGAATTTTGGGCTTTTTAACAATGGGCAAAAACGTTTGTAACATAATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCAGGCGGTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837665
dbEST ID: 79655367
Trimmed Sequence: CAGGCCAATTGTGTAAGAACGTCCTGTAGGATTATGAATTGCGGAGCACACAGGGGATGTTACAGCCCATTCGTACCAAACCTTCTTGCCATTGTTACAACGCCAAAATCGGACACAAACAGTATCACCCTCCCGCAAAGAAATGGGTTGCTTGATAGGAAAGAGGATGGGAAACCAAGAAAACATGCCCGGGGAGTGACTTTCAGGGCAAATACTCAGTGTCACATCTTTGTACAACACAGTGCTGAAATATCCAGCAAACCCATGTAGCACTGTGTTTAAGTCCACTCTGTACTGCAGGCAACAGTAGCGGTTATTATCAATGACAGCATCTTTGTTGGGATGGTGGAATGTGAAGCATGGCAAGGGATCTGATAACTGATGGAAGTTGTGTAGCCTCACTACATATGGCATCTCAAACTGAGCCTCGGGGTCTTTGTCTTTTTCCCTGCAAGCCCGTACCTCATTATACAGTTTGGATGACGATATTGGCGCCAAGAAAGAAGTGTATTCACCGGGAATACTAACTCCATCCTCTTTCAGGAAGTGCTGGGCTCCATCCAGACATTCAGGAGACAGCTCATTATCCCCAAATGATCCCAGAAGCTCGCTAACTATAATATCAGCCTTCTCAAGTGCCTTCCACTCTCTCATGTCACCAGACACCACAGTCACCTGACTGCCCCATTCCTCATAACGCCGGCCGTCTAACGTTATCACAGCATGTGGGATTCTTTTCCTACCGCGAGCACGTAAGTCTTGCGTCCAGCTTGCTTTGGAGGCTCTAAGGGAGGCATTCACAAGGGGTCCACCGGCCTCCCCCCGGGGTGCCACGTTTTTTGAATAAGGTTGGCATTCGAGCAAATCGTGGCTCAATCATTTGGTGGTACGAACGAGGGCAGTATGAGTCAAAAAAAAATCAAATAAAAGGAGACCCGACCGAAGCACTGCCCCTCCGTTGGCAACGTCGCCGAAAGGGGGGGGGGGGGAGGGGGAGGGGGGGGGGGGCGGCGAGGCGCCGGTGGGCAGGGTACGGGGGTGGGAAGGTGTCAANGGTAGGGAGGGGGGGGGGGGAGGGGGCGGGCGCCGGGGGGGGGAAAAGGGAGAGGGGGGGGGAGGGCGCCGGGCACGGAGAGGGAAGAGAGAAAGAGCACAGCGGAAGAGAGGAAGGAGGGAGGGAGAGCGGCCAAGCCGANGCAGGTAGAAAGAGGGAGAGAGGAGGAAGAGAGCAGGAGGGGGGGGGAGGGAGGAGGG
Full Trace Sequence: GGGCAGGGGAACAGCTTATGACCATGTTAATACGACTCCACTATAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGCCAATTGTGTAAGAACGTCCTGTAGGATTATGAATTGCGGAGCACACAGGGGATGTTACAGCCCATTCGTACCAAACCTTCTTGCCATTGTTACAACGCCAAAATCGGACACAAACAGTATCACCCTCCCGCAAAGAAATGGGTTGCTTGATAGGAAAGAGGATGGGAAACCAAGAAAACATGCCCGGGGAGTGACTTTCAGGGCAAATACTCAGTGTCACATCTTTGTACAACACAGTGCTGAAATATCCAGCAAACCCATGTAGCACTGTGTTTAAGTCCACTCTGTACTGCAGGCAACAGTAGCGGTTATTATCAATGACAGCATCTTTGTTGGGATGGTGGAATGTGAAGCATGGCAAGGGATCTGATAACTGATGGAAGTTGTGTAGCCTCACTACATATGGCATCTCAAACTGAGCCTCGGGGTCTTTGTCTTTTTCCCTGCAAGCCCGTACCTCATTATACAGTTTGGATGACGATATTGGCGCCAAGAAAGAAGTGTATTCACCGGGAATACTAACTCCATCCTCTTTCAGGAAGTGCTGGGCTCCATCCAGACATTCAGGAGACAGCTCATTATCCCCAAATGATCCCAGAAGCTCGCTAACTATAATATCAGCCTTCTCAAGTGCCTTCCACTCTCTCATGTCACCAGACACCACAGTCACCTGACTGCCCCATTCCTCATAACGCCGGCCGTCTAACGTTATCACAGCATGTGGGATTCTTTTCCTACCGCGAGCACGTAAGTCTTGCGTCCAGCTTGCTTTGGAGGCTCTAAGGGAGGCATTCACAAGGGGTCCACCGGCCTCCCCCCGGGGTGCCACGTTTTTTGAATAAGGTTGGCATTCGAGCAAATCGTGGCTCAATCATTTGGTGGTACGAACGAGGGCAGTATGAGTCAAAAAAAAATCAAATAAAAGGAGACCCGACCGAAGCACTGCCCCTCCGTTGGCAACGTCGCCGAAAGGGGGGGGGGGGGAGGGGGAGGGGGGGGGGGGCGGCGAGGCGCCGGTGGGCAGGGTACGGGGGTGGGAAGGTGTCAANGGTAGGGAGGGGGGGGGGGGAGGGGGCGGGCGCCGGGGGGGGGAAAAGGGAGAGGGGGGGGGAGGGCGCCGGGCACGGAGAGGGAAGAGAGAAAGAGCACAGCGGAAGAGAGGAAGGAGGGAGGGAGAGCGGCCAAGCCGANGCAGGTAGAAAGAGGGAGAGAGGAGGAAGAGAGCAGGAGGGGGGGGGAGGGAGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCCAATTGTGTAAGAAC