ORFeome > proc ORF1 – XORFeome v1.0

proc ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: proc
Gene ID: 973146
Gene Page ID: 973140
ORF Xenbase ID: 17290947

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054968
Original XGC clone length: 1368

Human orthology & disease relationships

NCBI Entrez ID: 5624
Ensembl gene IDs: ENSG00000115718
Directly associated (OMIM) disease MIM numbers: 176860,612304
Indirectly associated (Lage, et al.) disease MIM numbers: 122700,188050,188055,202400,231200,277450,607473

Library Location

Plate ID: GDExl11002
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ839260
dbEST ID: 79656962
Trimmed Sequence: ATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGTGTCTCCAAATGCAGAAAGCAGTCCAGTCTTCTCCAGCAGACAGGAGGCCAATCACGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTAGATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAAAATTGTAGACTATGACTATAATGCCCGTCTTATTGGTGCAAAGCAAGGACGCAAAAGGGATACTCCTTGGCAGGCCATGCTGCGTTACGAAGAGAAGATGAAATGTGGAGGGGTCCTGATTCATCCTTTCCTGGGTCCTGAACTGCACCCATTGCCGTTACATAAACCGGGAAAGTAAAGTGGTTCAAATTGGGTGAAATAAAAATTACCCCAAGTTGTGAAGAAAACCAAAAAAGAACAAGTTTTTGCCG
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTGTTTACCCTTCTACAGAATATGGTGGCTTCTTATTTTTCATTTAATTCTGGTCATTTGGGTGTCTCCAAATGCAGAAAGCAGTCCAGTCTTCTCCAGCAGACAGGAGGCCAATCACGTGCTGAAAGTTCGGAAGCGTGCTTTTAACTTCATGGAGGAGCTAAAGCCGGGCTCCCTGGAACGCGAGTGCATAGAGGAGAAGTGCGATTTCGAGGAGGCCTTCGAAATTTTTGAGACTAAAGAGGACACACTCAACTTTTGGGCAAAATATTTTGATGGGGATCAATGTCAGTCCAATCCATGTGTCAATGCAGAGTGCAAGGATGGGATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGGCGTCTGTGTGGCTATGAGGTTGTGTATTCCAACTGCTCATTGAATAATGGAGGATGTAGCCACTTCTGCACCCAGCCAATGAATAGCACGAGGCGTGTGTGCAGCTGTGCCACGGGATACAAGTTAGATGAAGACCACCACACGTGCCAACCAGTAGTGGAATTCCCCTGTGGGAAATCGAAAATTGTAGACTATGACTATAATGCCCGTCTTATTGGTGCAAAGCAAGGACGCAAAAGGGATACTCCTTGGCAGGCCATGCTGCGTTACGAAGAGAAGATGAAATGTGGAGGGGTCCTGATTCATCCTTTCCTGGGTCCTGAACTGCACCCATTGCCGTTACATAAACCGGGAAAGTAAAGTGGTTCAAATTGGGTGAAATAAAAATTACCCCAAGTTGTGAAGAAAACCAAAAAAGAACAAGTTTTTGCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTGTTTACCCTTCTACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839259
dbEST ID: 79656961
Trimmed Sequence: AGGTCGGGCTTTGCGGGATTTGTTGATGTTTTGCTTTTCTGCCTGGGATACCTCAGAGAGACGACGGGCCTCTTCATCCTCGATCTTTTGTGTAATCCAGTCCAGATAACGGTTGACTTTGGTATAAACACCAAAATTATTAATTCTCCCACAGCCTTCCCCCCAGCTTACCAGCCCCAGCAGAAACCAGGATCCTCCATACTTAGTGACCATAGGCCCACCGCTGTCACCATAGCAGGCGTCTTGTATATGTCCCAGGCGCCCCGCACACAGCATATTGTCAGACAATCTATCATTTAGGGTTTCAGCGCATTGATTATGAGAAACAACAGGGATCTGGATGTAGCTGAGTACACTAGAAAAGTTTAGGGCCTTTTCATCTTCTCTGCCCCAGCCGGAAACCACGACTACNGTGCCATTCACCATCAGGGTATTTTCAGCAAGGTCCAGACTGGGCAGACATATGGGCAGGATATATTTGTTATAGACAACTGGCTGCACGAGGCGCAGTANGGCGATATCATTATCATTGGTGTCACTTCGATACTCAAGATGGATAATGATCTTGACCACAGCAAACTGCTGCTCTGTATCCTCCCACTTGCGTATGTCGTAATCACCAAGTCGAAAACTGTACTTTCCAGTATATTGTAACGCATTGGGCTGCCATTCGAACCCAGGAAAGGATAAAATCAGGGACCCCCTCCCATTTTTCACCCTTCTTCCCTCTAAACCCCAACCCAGGGCCCCGGCCCCAGGGAA
Full Trace Sequence: GACGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGTCGGGCTTTGCGGGATTTGTTGATGTTTTGCTTTTCTGCCTGGGATACCTCAGAGAGACGACGGGCCTCTTCATCCTCGATCTTTTGTGTAATCCAGTCCAGATAACGGTTGACTTTGGTATAAACACCAAAATTATTAATTCTCCCACAGCCTTCCCCCCAGCTTACCAGCCCCAGCAGAAACCAGGATCCTCCATACTTAGTGACCATAGGCCCACCGCTGTCACCATAGCAGGCGTCTTGTATATGTCCCAGGCGCCCCGCACACAGCATATTGTCAGACAATCTATCATTTAGGGTTTCAGCGCATTGATTATGAGAAACAACAGGGATCTGGATGTAGCTGAGTACACTAGAAAAGTTTAGGGCCTTTTCATCTTCTCTGCCCCAGCCGGAAACCACGACTACNGTGCCATTCACCATCAGGGTATTTTCAGCAAGGTCCAGACTGGGCAGACATATGGGCAGGATATATTTGTTATAGACAACTGGCTGCACGAGGCGCAGTANGGCGATATCATTATCATTGGTGTCACTTCGATACTCAAGATGGATAATGATCTTGACCACAGCAAACTGCTGCTCTGTATCCTCCCACTTGCGTATGTCGTAATCACCAAGTCGAAAACTGTACTTTCCAGTATATTGTAACGCATTGGGCTGCCATTCGAACCCAGGAAAGGATAAAATCAGGGACCCCCTCCCATTTTTCACCCTTCTTCCCTCTAAACCCCAACCCAGGGCCCCGGCCCCAGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGTCGGGCTTTGCGGGATT