ORFeome > prosc ORF1 – XORFeome v1.0

prosc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prosc
Gene ID: 6255245
Gene Page ID: 950134
ORF Xenbase ID: 17290977

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129541
Original XGC clone length: 786

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ838666
dbEST ID: 79656368
Trimmed Sequence: ATGTCAGAGGAGATAGGGAAAGCTTTGCAGTCTGTGCGGGAGAGGGTCCAGCATGCTGCAGCCAGGAGGATCAAGACTCTGCCAGCAATTGATCCCAGGCTGGTGGCGGTCAGTAAAACGAAGCCAGTGGACGTGGTGATTGAAGCTTACAGACATGGGCAGCGATACTTCGGAGAAAACTATGTTCAAGAGTTAGCTGAAAAGGCTTCAGATCCAAGTCTTCTATCTTCTTGCCCAGACATCAAATGGCACTTTATCGGGCATCTGCAGAAGACACACATCAACAAGTTAGTTGGTGTCCCAAACCTTTACATTCCGGAGACCGTAGACTCAGTGAAACTGGCTGACAAGGTAAACAGTTCCTGGCAGAAGAAGGGATCGTCAGAAAAGCTAAAGGTCATGGTGCAGGTGAACACAAACAGTGAGGACAGTAAGTATGGCCTTGCACCAGCTGAAACTGCAGGACTTGTTAAACATATCAAAGAGAAATGCCCCAGCCTTGGAAGTTGTGGGGGCGGATGGACAATTGGGAGCGATGGTTATGATCTAACCCAAGGGACCGGATCCCTGAATTTTCAAATGCTAGCAGGGGGCAGAAGAAAGATAGGTGGGGAAAAGAGCTGGCAAAGTAAAATCGAACTCTGATGGAGCGCAGGTTTGGGGAGAGTGGCGCGGAATTGTAAGAAAGGCAAATATAAAGTTGGGGATCGGCAAACGGGGAAAAAAATAGGGGGAGCAATTGGAAGGG
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGGAGATAGGGAAAGCTTTGCAGTCTGTGCGGGAGAGGGTCCAGCATGCTGCAGCCAGGAGGATCAAGACTCTGCCAGCAATTGATCCCAGGCTGGTGGCGGTCAGTAAAACGAAGCCAGTGGACGTGGTGATTGAAGCTTACAGACATGGGCAGCGATACTTCGGAGAAAACTATGTTCAAGAGTTAGCTGAAAAGGCTTCAGATCCAAGTCTTCTATCTTCTTGCCCAGACATCAAATGGCACTTTATCGGGCATCTGCAGAAGACACACATCAACAAGTTAGTTGGTGTCCCAAACCTTTACATTCCGGAGACCGTAGACTCAGTGAAACTGGCTGACAAGGTAAACAGTTCCTGGCAGAAGAAGGGATCGTCAGAAAAGCTAAAGGTCATGGTGCAGGTGAACACAAACAGTGAGGACAGTAAGTATGGCCTTGCACCAGCTGAAACTGCAGGACTTGTTAAACATATCAAAGAGAAATGCCCCAGCCTTGGAAGTTGTGGGGGCGGATGGACAATTGGGAGCGATGGTTATGATCTAACCCAAGGGACCGGATCCCTGAATTTTCAAATGCTAGCAGGGGGCAGAAGAAAGATAGGTGGGGAAAAGAGCTGGCAAAGTAAAATCGAACTCTGATGGAGCGCAGGTTTGGGGAGAGTGGCGCGGAATTGTAAGAAAGGCAAATATAAAGTTGGGGATCGGCAAACGGGGAAAAAAATAGGGGGAGCAATTGGAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGGAGATAGGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838665
dbEST ID: 79656367
Trimmed Sequence: TGATTTGTTCTGGGTACTGGTTACATTTGCGCCTTCCTTCACAGCCTTAGAGTAAACCCGATCACCAAATAAAGTGCTGCCAATTCGCACGTTTGTGGATCCAACCTCAATTGCATGCTCAAAATCCGAGGACATTCCCATACTGAGCTCCACAGAGTCGATCTGAAGTCCCAGCTTTTCACACACCATATCCCTCTGAGCCAGCAGCATCTGAAAATCAGGATTGGGTCCCTGGGTTAGATCATAACCAAAGCTCCCAATTGTCATCAGCCCCACAAATTCCAGGCTGGGGCATTTCTCTCTGATATGTTTAACAAGTCCTGCAGTTTCAGCTGGTGCAAGGCCATACTTACTGTCCTCACTGCTTGTGTTCACCTGCACCATGACCTTTAGCTTTTCTGACGATCCCTTCTTTTGCCAGGAACTGTTTACCTTGTCAGCCAGTTTCACTGAGTCTATGGTCTCCGGAATGTAAAGGTTTGGGACACCAACTAACTTGTTGATGTGTGTCTTCTGCAAATGCCCGAACAAATGCCATTTTATGTCTGGGCAAAAAATAAAAAACTTGGAATCTAAACCTTTTCCGCTAACTCTTGAACATAGTTTTCTCCAAAATATCGCTGCCCATGTCTGGTAAGCTTCAATCACCACGTCCACTTGGCTTTCTTTTAATTGACCGCCACCAGCCCGGGGCATCAGTTGGCTGGGGGGAAGTCTTTATCCCCCCCTGGCTTGCCGCACTGCCTGGGACCCCTTCCC
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATTTGTTCTGGGTACTGGTTACATTTGCGCCTTCCTTCACAGCCTTAGAGTAAACCCGATCACCAAATAAAGTGCTGCCAATTCGCACGTTTGTGGATCCAACCTCAATTGCATGCTCAAAATCCGAGGACATTCCCATACTGAGCTCCACAGAGTCGATCTGAAGTCCCAGCTTTTCACACACCATATCCCTCTGAGCCAGCAGCATCTGAAAATCAGGATTGGGTCCCTGGGTTAGATCATAACCAAAGCTCCCAATTGTCATCAGCCCCACAAATTCCAGGCTGGGGCATTTCTCTCTGATATGTTTAACAAGTCCTGCAGTTTCAGCTGGTGCAAGGCCATACTTACTGTCCTCACTGCTTGTGTTCACCTGCACCATGACCTTTAGCTTTTCTGACGATCCCTTCTTTTGCCAGGAACTGTTTACCTTGTCAGCCAGTTTCACTGAGTCTATGGTCTCCGGAATGTAAAGGTTTGGGACACCAACTAACTTGTTGATGTGTGTCTTCTGCAAATGCCCGAACAAATGCCATTTTATGTCTGGGCAAAAAATAAAAAACTTGGAATCTAAACCTTTTCCGCTAACTCTTGAACATAGTTTTCTCCAAAATATCGCTGCCCATGTCTGGTAAGCTTCAATCACCACGTCCACTTGGCTTTCTTTTAATTGACCGCCACCAGCCCGGGGCATCAGTTGGCTGGGGGGAAGTCTTTATCCCCCCCTGGCTTGCCGCACTGCCTGGGACCCCTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATTTGTTCTGGGTACTGGTT