ORFeome > prrc1 ORF1 – XORFeome v1.0

prrc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prrc1
Gene ID: 6252936
Gene Page ID: 5777679
ORF Xenbase ID: 17291091

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124873
Original XGC clone length: 1329

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ838151
dbEST ID: 79655853
Trimmed Sequence: ATGATGGAAGAGAGTGGTATTGAAACAACACCTCCAAGCACCCCTCCTCCCAGCACCATTGGAACATCAGTAGCCGCATCTACATCAGCCATCTTCACCCCTGTTCCACCAGTTTTGTCCAGCCCTCTGGCTGCACCAGCATTCTCCCCACTGCCATCTTTTGCACAGTCAAGTTTTTCTACCCCGGTGCCTTCCTCGGTTCCTCCACTGAGAACATCGGTCCCTCTCACATATGCTTCTCCCCTTCCTGTCACTTCGGTCTACTCTCCTCCTGCCAACACCTCTGTATCTGCTGCTTTTAGCAGCCCATTACCAGCATTTTCTTCTCCACCATCTTTCCCCCCTCCTCCTCTGAACACAACTCCAGGTCCAGTTCTCACAGCACCACCCATGAATCCACCTGTAGGAGGATTCTCTATGTCTTCCACCTACGATATCACTAAAGGTCATGCTGGACGAGCACCTCAGACCCCTCTGATGCCAACATACTCTGCTGCCCCTGTCACAGTTCTGCCAAATCCTGTTGTACAAGCTCCTATAGCAGGGATTGGATCTTCCATTACATTCCCTGAGGAACCTGAAGACCCCAGGGTACATACNATGCACGATGAAAGCTCTGCTGGAGGCATCTGGGGATTCATTAAGGGAGTAGCTGGAAATCCAATGGTGGAATCGGTGCTTGATAAAACTAACACTCAATGGAAACTGTGATTAAGCACTCTGGACCCTGGCCTGCCATCATATATCCGAAACCGTGGGAAATTGTGAAATGN
Full Trace Sequence: CGGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGAAGAGAGTGGTATTGAAACAACACCTCCAAGCACCCCTCCTCCCAGCACCATTGGAACATCAGTAGCCGCATCTACATCAGCCATCTTCACCCCTGTTCCACCAGTTTTGTCCAGCCCTCTGGCTGCACCAGCATTCTCCCCACTGCCATCTTTTGCACAGTCAAGTTTTTCTACCCCGGTGCCTTCCTCGGTTCCTCCACTGAGAACATCGGTCCCTCTCACATATGCTTCTCCCCTTCCTGTCACTTCGGTCTACTCTCCTCCTGCCAACACCTCTGTATCTGCTGCTTTTAGCAGCCCATTACCAGCATTTTCTTCTCCACCATCTTTCCCCCCTCCTCCTCTGAACACAACTCCAGGTCCAGTTCTCACAGCACCACCCATGAATCCACCTGTAGGAGGATTCTCTATGTCTTCCACCTACGATATCACTAAAGGTCATGCTGGACGAGCACCTCAGACCCCTCTGATGCCAACATACTCTGCTGCCCCTGTCACAGTTCTGCCAAATCCTGTTGTACAAGCTCCTATAGCAGGGATTGGATCTTCCATTACATTCCCTGAGGAACCTGAAGACCCCAGGGTACATACNATGCACGATGAAAGCTCTGCTGGAGGCATCTGGGGATTCATTAAGGGAGTAGCTGGAAATCCAATGGTGGAATCGGTGCTTGATAAAACTAACACTCAATGGAAACTGTGATTAAGCACTCTGGACCCTGGCCTGCCATCATATATCCGAAACCGTGGGAAATTGTGAAATGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGAAGAGAGTGGTATTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838150
dbEST ID: 79655852
Trimmed Sequence: AAGGATTCTGGGTGAAAGTCTTTGCTTGTACATTCCAGCTAGGGCTTTGGTGGCACTGTATATCATCTGTCTGCGAGACATGCCTGTAAATGCCACGTGCCAGTCAGTCCGGCTGACGTGCGCTAAACTTCTTTCCAAGACTTCACCCACGGTCACAGACAGCCCAGACCACCTGAGATTGTAGTCTTGGGGTGTGAGATTTTGGGCCTGCTGTACATATTCCAAAGGCACAGGTGTTGCTTGTGTGAAGGCTTCCAAACGTATGCCATGGACAGGGTCGTCCATAATTACACAGCCAATGTCAAACCATTTGTCAGGGAGAAGTTCTGCGATGAAATTTTCCACCGATACAGCAGGCTGTTTCTCATGAATCATCCCAGTTCGGCGCAAACTGTCAATCCTTTCTTGAGCGCCCTTTAATCCTGCCGCATATCCAACAGGTTGAGGTGCAATGTTAGACTGACCATCTTCCCCTGATACCACTGCCATGCCAAACACCTCCTGAAAAGCATCTCGCACTGCGGAAACCTTCACTTCTTTAATCAATGTGACCACAATGTCCAATTCTCCAACGGTTCCGAATATTGAAGGCCTGCCAGGGTCCGGAAGGGTAATCACAATTTTCCATTAAATGCTTAATTTTTTTCAAACCCCATTTTCCCGAGTGGAATTTCCACCCACTCCCCTTTAGAAATCCCGCGAATGCCCCCCACCAAAAAACCCTCCACCCATGCCATTTGGTTGGATACCCGGGGGGGGTCCTTTCAGGG
Full Trace Sequence: GGGGAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGATTCTGGGTGAAAGTCTTTGCTTGTACATTCCAGCTAGGGCTTTGGTGGCACTGTATATCATCTGTCTGCGAGACATGCCTGTAAATGCCACGTGCCAGTCAGTCCGGCTGACGTGCGCTAAACTTCTTTCCAAGACTTCACCCACGGTCACAGACAGCCCAGACCACCTGAGATTGTAGTCTTGGGGTGTGAGATTTTGGGCCTGCTGTACATATTCCAAAGGCACAGGTGTTGCTTGTGTGAAGGCTTCCAAACGTATGCCATGGACAGGGTCGTCCATAATTACACAGCCAATGTCAAACCATTTGTCAGGGAGAAGTTCTGCGATGAAATTTTCCACCGATACAGCAGGCTGTTTCTCATGAATCATCCCAGTTCGGCGCAAACTGTCAATCCTTTCTTGAGCGCCCTTTAATCCTGCCGCATATCCAACAGGTTGAGGTGCAATGTTAGACTGACCATCTTCCCCTGATACCACTGCCATGCCAAACACCTCCTGAAAAGCATCTCGCACTGCGGAAACCTTCACTTCTTTAATCAATGTGACCACAATGTCCAATTCTCCAACGGTTCCGAATATTGAAGGCCTGCCAGGGTCCGGAAGGGTAATCACAATTTTCCATTAAATGCTTAATTTTTTTCAAACCCCATTTTCCCGAGTGGAATTTCCACCCACTCCCCTTTAGAAATCCCGCGAATGCCCCCCACCAAAAAACCCTCCACCCATGCCATTTGGTTGGATACCCGGGGGGGGTCCTTTCAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGATTCTGGGTGAAAGTCTTTG