ORFeome > prss1 ORF1 – XORFeome v1.0

prss1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prss1
Gene ID: 5776767
Gene Page ID: 5776261
ORF Xenbase ID: 17291127

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123311
Original XGC clone length: 735

Human orthology & disease relationships

NCBI Entrez ID: 5644
Ensembl gene IDs: ENSG00000204983,ENSG00000274247
Directly associated (OMIM) disease MIM numbers: 167800,614044
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ837466
dbEST ID: 79655168
Trimmed Sequence: ATGAAGTTCCTCGTCATCTTGGTCTTGCTGGGAGCAGCCGTTGCTTTTGAAGATGATGATAAGATTGTAGGGGGTTTTACGTGCGCCAAGAACGCTGTTCCCTATCAAGTGTCCCTAAACGCTGGTTACCATTTCTGTGGGGGGTCCTTGATTAACAGTCAGTGGGTGGTGTCTGCCGCTCATTGCTACAAATCTCGTATCCAGGTCAGACTTGGGGAGCACAACATCGCTTTAAATGAAGGGACAGAACAATTCATTGATTCACAGAAAGTCATCAAGCACCCCAACTACAACTCCTGGAACCTGGACAATGACATCATGTTGATCAAACTTTCCACCACTGCCAGACTTACCGCCAACATCCAATCCGTGCCTCTGCCCTCGGCCTGTGCTTCTGCCGGCACCAACTGCCTGATCTCTGGCTGGGGGAACACCCTGAGCAGCGGCACCAATTACCCAGATCTCCTGCAGTGCCTGAGTGCCCCAGTCCTGACTGACAGTCAGTGCAGTAACAGCTACCCCGGGGAGATCACCAAGAACATGTTCTGTGCCGGCTTTTTGGCTGGTGGCGGAGACTCTTGCCAGGAGGATTCTGGTGGCCCCGGGGTGTGCAATGGGCACCTGCCAGGTGTGGTAGCCTGGGTTTTTGGGTTGTGCCAGAAGGAAAAACCCGATGTCCATGCCAAAGACCTGCAGGTTTTGGACTTGGATCCGGAGACCGATGTCCCCAAACTGGGCACATTGGCTGGAAAAAAAGGGCAAAATTAGAAAAAAAAGTTAAGAGAAAAGAGTGGNNCGCGGGAAAAAAAAGAAAAAAAAAAAAA
Full Trace Sequence: GACCCCAAATAATGGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTTCCTCGTCATCTTGGTCTTGCTGGGAGCAGCCGTTGCTTTTGAAGATGATGATAAGATTGTAGGGGGTTTTACGTGCGCCAAGAACGCTGTTCCCTATCAAGTGTCCCTAAACGCTGGTTACCATTTCTGTGGGGGGTCCTTGATTAACAGTCAGTGGGTGGTGTCTGCCGCTCATTGCTACAAATCTCGTATCCAGGTCAGACTTGGGGAGCACAACATCGCTTTAAATGAAGGGACAGAACAATTCATTGATTCACAGAAAGTCATCAAGCACCCCAACTACAACTCCTGGAACCTGGACAATGACATCATGTTGATCAAACTTTCCACCACTGCCAGACTTACCGCCAACATCCAATCCGTGCCTCTGCCCTCGGCCTGTGCTTCTGCCGGCACCAACTGCCTGATCTCTGGCTGGGGGAACACCCTGAGCAGCGGCACCAATTACCCAGATCTCCTGCAGTGCCTGAGTGCCCCAGTCCTGACTGACAGTCAGTGCAGTAACAGCTACCCCGGGGAGATCACCAAGAACATGTTCTGTGCCGGCTTTTTGGCTGGTGGCGGAGACTCTTGCCAGGAGGATTCTGGTGGCCCCGGGGTGTGCAATGGGCACCTGCCAGGTGTGGTAGCCTGGGTTTTTGGGTTGTGCCAGAAGGAAAAACCCGATGTCCATGCCAAAGACCTGCAGGTTTTGGACTTGGATCCGGAGACCGATGTCCCCAAACTGGGCACATTGGCTGGAAAAAAAGGGCAAAATTAGAAAAAAAAGTTAAGAGAAAAGAGTGGNNCGCGGGAAAAAAAAGAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTTCCTCGTCATCTTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837465
dbEST ID: 79655167
Trimmed Sequence: GTTAGAGGAAATGGTGCTCTGGATCCAAGTCACAAAGTTGCAAAATTTTATTATAGACACCAGGATAGTTCCTCTGGGCACAGCCATAACCCCAGGATACCACACCCTGCAGCTGCCCATTGCACACCACGGGGCCACCAGAATCACCCTGGCAAGAGTCTTTGCCACCAGCCAAAAAGCCGGCACAGAACATGTTCTTGGTGATCTCCCCGGGGTAGCTGTTACTGCACTGACTGTCAGTCAGGACTGGGGCATTCAGGCACTGCAGGAGATCTGGGTAATTGGTGCCGCTGCTCAGGGTGTTCCCCCAGCCAGAGATCAGGCAGTTGGTGCCGGCAGAAGCACAGGCCGAGGGCAGAGGCACGGATTGGATGTTGGCGCTAAGTCTGGCAGTGGTGGAAAGTTTGATCAACATGATGTCATTGTCCAGGTTCCTGGAGTTGTAATTGGGGTGCTTGATGACATTCTATGAATCAATCAAATGTTCTGTCCCTTCCATTAAAGCAATGTTGTTCTCCCCCAGTCGGACCTGGATACAACAATTTTAGTAGTGAGGGGGGGGAGCCGACCCCCGGGACTGTTAAACAAAAGACCGGCCGCAAAAAAAGGTGGGCGAGGGGTTTAGGAAAAAAAAATAAAAAAAAAACAAATTGTGTAACGCCGTTGGGAAACGCGGGGCGAACCGAAAAGACAGGTGGTTCCAATGGTGGCGCGCAAGGGGGGCGGGCCAAAAAAAAAGGTAAAAATAAGGGGGAGAAA
Full Trace Sequence: AAAACGGCTATTGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTAGAGGAAATGGTGCTCTGGATCCAAGTCACAAAGTTGCAAAATTTTATTATAGACACCAGGATAGTTCCTCTGGGCACAGCCATAACCCCAGGATACCACACCCTGCAGCTGCCCATTGCACACCACGGGGCCACCAGAATCACCCTGGCAAGAGTCTTTGCCACCAGCCAAAAAGCCGGCACAGAACATGTTCTTGGTGATCTCCCCGGGGTAGCTGTTACTGCACTGACTGTCAGTCAGGACTGGGGCATTCAGGCACTGCAGGAGATCTGGGTAATTGGTGCCGCTGCTCAGGGTGTTCCCCCAGCCAGAGATCAGGCAGTTGGTGCCGGCAGAAGCACAGGCCGAGGGCAGAGGCACGGATTGGATGTTGGCGCTAAGTCTGGCAGTGGTGGAAAGTTTGATCAACATGATGTCATTGTCCAGGTTCCTGGAGTTGTAATTGGGGTGCTTGATGACATTCTATGAATCAATCAAATGTTCTGTCCCTTCCATTAAAGCAATGTTGTTCTCCCCCAGTCGGACCTGGATACAACAATTTTAGTAGTGAGGGGGGGGAGCCGACCCCCGGGACTGTTAAACAAAAGACCGGCCGCAAAAAAAGGTGGGCGAGGGGTTTAGGAAAAAAAAATAAAAAAAAAACAAATTGTGTAACGCCGTTGGGAAACGCGGGGCGAACCGAAAAGACAGGTGGTTCCAATGGTGGCGCGCAAGGGGGGCGGGCCAAAAAAAAAGGTAAAAATAAGGGGGAGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTAGAGGAAATGGTGCTCTG