ORFeome > prss2 ORF1 – XORFeome v1.0

prss2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prss2
Gene ID: 6065272
Gene Page ID: 6065253
ORF Xenbase ID: 17291139

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC122479
Original XGC clone length: 417

Human orthology & disease relationships

NCBI Entrez ID: 5645
Ensembl gene IDs: ENSG00000204983
Directly associated (OMIM) disease MIM numbers: 167800
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ838034
dbEST ID: 79655736
Trimmed Sequence: ATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGGGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAAGGTCTGCAACTACAACTCCTGGATCCAGAGCACCATTGCTGCCAACTT
Full Trace Sequence: CTCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGGGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAAGGTCTGCAACTACAACTCCTGGATCCAGAGCACCATTGCTGCCAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTACAAATCAAAAAAAAAAAATATAACAAAAACGAGCGAAACGACACGGCCCGGAAGAAAAAACTGACCTCCGAGCACCCAAGGGTGCCTGGTGTGGCAATCGTGGGAAAAGGAAAAGAAAAAAAAAAATGGAAAAAAGACAGGTATTTCTCTATTTGTAAGACATAACAGGAAAGCCCCAACACAAGTGGGCCAAAAATTTACCAAAACCCCGGGGGGGATAAGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGATCAAACTTGCCTCTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838033
dbEST ID: 79655735
Trimmed Sequence: GTTGGCAGCAATGGTGCTCTGGATCCAGGAGTTGTAGTTGCAGACCTTGGTGTAGACACCAGGATAGTTCCTCTGGGCACAGCCGACTCCCCAGGACACAATACCCTGCAACTGCCCATTACACACCACGGGGCCACCAGAGTCACCCTGGCAGGAGTCCTTGCCACCCTCCAAGAATCCAGCACAGAACATGTTGTTGGTGATCTGCCCGGGGTAGGCACCTGTACATTGGGCGGTAGTCAGGATGGGGGCACTCAAGCACTGCAGGAGGTTGGGGTAATTGGAGCCACTGGTGGAAGTGTTGCCCCAGCCAGAGATCANGCAGCTGGAACCAGCGGCGGCACAACTAGAAAGCAGAGCCACAGCATTCACATTGGAATTAAGGGAGGCAGGAGAGGCAAGTTTGATCAACATGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGCAGCAATGGTGCTCTGGATCCAGGAGTTGTAGTTGCAGACCTTGGTGTAGACACCAGGATAGTTCCTCTGGGCACAGCCGACTCCCCAGGACACAATACCCTGCAACTGCCCATTACACACCACGGGGCCACCAGAGTCACCCTGGCAGGAGTCCTTGCCACCCTCCAAGAATCCAGCACAGAACATGTTGTTGGTGATCTGCCCGGGGTAGGCACCTGTACATTGGGCGGTAGTCAGGATGGGGGCACTCAAGCACTGCAGGAGGTTGGGGTAATTGGAGCCACTGGTGGAAGTGTTGCCCCAGCCAGAGATCANGCAGCTGGAACCAGCGGCGGCACAACTAGAAAGCAGAGCCACAGCATTCACATTGGAATTAAGGGAGGCAGGAGAGGCAAGTTTGATCAACATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTTTTGCAACGAACAGGTCACTATTCATTCAAAAAAAAACCTTTATTTNTAAAAAAAAAAAAAAAAAAAAAAAAAATTATAAATACTTAATGGGGCCCTGCCACGACCGGAAAAAAAAGAAGGCAATTCCCAGCACCGGGCGTTGCGGGGTGCGGTTGTTTGGGGGAAGAGAGGAAAAGGGGAAAACCAAAGGAAAATAAGGGGGGTGGGGTTGGGGAGATTGGTATGCAAATAACCCAAAAGGGCCCCCCACCCAAACGTGGCGCCCAAAACCTGCCCAAAACCACGAAGGGGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGCAGCAATGGTGCTC