ORFeome > prss3 ORF1 – XORFeome v1.0

prss3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: prss3
Gene ID: 6254555
Gene Page ID: 6372191
ORF Xenbase ID: 17291145

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078492
Original XGC clone length: 747

Human orthology & disease relationships

NCBI Entrez ID: 5646
Ensembl gene IDs: ENSG00000010438
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,188055,277450,603813,607473,609065

Library Location

Plate ID: GDExl11004
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ839710
dbEST ID: 79657412
Trimmed Sequence: ATGATGCCTATCTGGGTATTGATGTTCCTGGCAGTTGCAGCTGCAGCTCCTCTGGATGACGATAAGATTATAGGGGGATATGAATGCACCCCTCACTCTCAGCCCTGGCAGGTTTATTTAACCCAAAATGGAGACCGCTGGTGTGGGGGTTCACTTATCTTACCAAGGTGGATTATTTCTGCTGCACATTGCTACGTTCCACCCGAGACCATGGTTGCTCACCTTGGAGAACATGACCTTAATAAGAAGGAGACAACTGAGCAGCACATCCAAGTGGAGAGCATCTACATGCACCACGGCTACAATGAGGATACTTATGACAATGATATCATGTTGGTTAAACTAGTGGAACCTGCTCAGTATAATCAGTATGTACAGCCCATCCCAGTGGCAAGAAGCTGCCCAAAAGCGGCGACTGAGTGCCTTGTGTCTGGCTATGGAAATCTGCTAGCGTATGGTGTGAAGTACGCTGATCAATTGCAGTGCCTAGATCTGCCCATTCTGTCTGAATCCAGCTGTAAGGCTTCATATCCCAAGAAGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAAGGTGACTCTGGTGGACCTCTGATTTGCAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGTACTGGTCCCAGGAAGGATCCTCCAGGAGTTTATGCTAAAGTCTGTAACTATCTAGACTGGAATACAGGACATTACAAATTACCACTTTGGCCACTTTTCCTTTGTCCAAGTTTGGGCTTTATAAGAAAACCATTTGGCTTATCAATTTTTTTTTGCA
Full Trace Sequence: CGAGGGCCCAATAANTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGCCTATCTGGGTATTGATGTTCCTGGCAGTTGCAGCTGCAGCTCCTCTGGATGACGATAAGATTATAGGGGGATATGAATGCACCCCTCACTCTCAGCCCTGGCAGGTTTATTTAACCCAAAATGGAGACCGCTGGTGTGGGGGTTCACTTATCTTACCAAGGTGGATTATTTCTGCTGCACATTGCTACGTTCCACCCGAGACCATGGTTGCTCACCTTGGAGAACATGACCTTAATAAGAAGGAGACAACTGAGCAGCACATCCAAGTGGAGAGCATCTACATGCACCACGGCTACAATGAGGATACTTATGACAATGATATCATGTTGGTTAAACTAGTGGAACCTGCTCAGTATAATCAGTATGTACAGCCCATCCCAGTGGCAAGAAGCTGCCCAAAAGCGGCGACTGAGTGCCTTGTGTCTGGCTATGGAAATCTGCTAGCGTATGGTGTGAAGTACGCTGATCAATTGCAGTGCCTAGATCTGCCCATTCTGTCTGAATCCAGCTGTAAGGCTTCATATCCCAAGAAGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAAGGTGACTCTGGTGGACCTCTGATTTGCAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGTACTGGTCCCAGGAAGGATCCTCCAGGAGTTTATGCTAAAGTCTGTAACTATCTAGACTGGAATACAGGACATTACAAATTACCACTTTGGCCACTTTTCCTTTGTCCAAGTTTGGGCTTTATAAGAAAACCATTTGGCTTATCAATTTTTTTTTGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCCTATCTGGGTATTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839709
dbEST ID: 79657411
Trimmed Sequence: GTTGTTATTTGTAATGTCCTGTATCCAGTCTAGATAGTTACAGACTTTAGCATAAACTCCTGGAAGATCCTTCCTGGCACAGTACCATCCCCATGAGACCACTCCATAGAGTTCTCCATTGCAAATCAGAGGTCCACCAGAGTCACCCTGGCATGAATCCTTTCCACCTTCCAGGAAGCCGGCACAGAACATGTTCTCAGAAATCTTCTTGGGATATGAAGCCTTACAGCTGGATTCAGACAGAATGGGCAGATCTAGGCACTGCAATTGATCAGCGTACTTCACACCATACGCTAGCAGATTTCCATAGCCAGACACAAGGCACTCAGTCGCCGCTTTTGGGCAGCTTCTTGCCACTGGGATGGGCTGTACATACTGATTATACTGAGCAGGTTCCACTAGTTTAACCAACATGATATCATTGTCATAAGTATCCTCATTGTAGCCGTGGTGCATGTAGATGCTCTCCACTTGGATGTGCTGCTCAGTTGTCTCCTTCTTATTAAGGTCATGTTCTCCAAGGTGAGCAACCCTGGTCTCGGGTGGAACGTAGCAATGTGCAACAAAAATAATCCACCTTGGTAAGATAAATGAAACCCCCCCACCACCGGTCTCCATTTTTGGTTAAATAAACCGGCCCGGGCCGAAAAATGAAGGGGTGGATTTCATATCCCCCCTATTAATCCTTATCTTCCTCCCAAGGAAGCTGCCCCCTTGAAACCGGGCCCAGAAACAATCAAAATAACCCAAAAATTAGG
Full Trace Sequence: GGAAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGTTATTTGTAATGTCCTGTATCCAGTCTAGATAGTTACAGACTTTAGCATAAACTCCTGGAAGATCCTTCCTGGCACAGTACCATCCCCATGAGACCACTCCATAGAGTTCTCCATTGCAAATCAGAGGTCCACCAGAGTCACCCTGGCATGAATCCTTTCCACCTTCCAGGAAGCCGGCACAGAACATGTTCTCAGAAATCTTCTTGGGATATGAAGCCTTACAGCTGGATTCAGACAGAATGGGCAGATCTAGGCACTGCAATTGATCAGCGTACTTCACACCATACGCTAGCAGATTTCCATAGCCAGACACAAGGCACTCAGTCGCCGCTTTTGGGCAGCTTCTTGCCACTGGGATGGGCTGTACATACTGATTATACTGAGCAGGTTCCACTAGTTTAACCAACATGATATCATTGTCATAAGTATCCTCATTGTAGCCGTGGTGCATGTAGATGCTCTCCACTTGGATGTGCTGCTCAGTTGTCTCCTTCTTATTAAGGTCATGTTCTCCAAGGTGAGCAACCCTGGTCTCGGGTGGAACGTAGCAATGTGCAACAAAAATAATCCACCTTGGTAAGATAAATGAAACCCCCCCACCACCGGTCTCCATTTTTGGTTAAATAAACCGGCCCGGGCCGAAAAATGAAGGGGTGGATTTCATATCCCCCCTATTAATCCTTATCTTCCTCCCAAGGAAGCTGCCCCCTTGAAACCGGGCCCAGAAACAATCAAAATAACCCAAAAATTAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTTATTTGTAATGTCCTGT