ORFeome > pskh1 ORF1 – XORFeome v1.0

pskh1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pskh1
Gene ID: 947386
Gene Page ID: 947380
ORF Xenbase ID: 17291205

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078579
Original XGC clone length: 993

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ839870
dbEST ID: 79657572
Trimmed Sequence: ATGGGTTGTGGGACGAGTAAAGTTCTCCCTGAACCTTCAAAAAACCTCCAGCTGGACTTGGTGAAAAAAGTGGAACCTTGTTTGGACTCAAAAAGTGACCAATATAATACTTTTATCACAGACACAAGCCAGACATTTGTAAAGGATGATTACCTATGTCACTCATTGCAGAATGGCGACTCAAAGTGTCATGTGGAAAGTACTCACTTAAGGAGACATAAAATTGCTAAGTACAGGGCTAAGTTTGACCCACGTGTAACTGCAAAATATGACATAAAAGCTCTTATTGGACGAGGTAGTTTCAGTCGTGTTGTAAGAGTAGAACATAAGGCCTCTAAACAGCCGTATGCTATTAAAATGATTGAAACAAAATACAGAGAAGGCAGGGAGGTGTGTGAATCTGAGCTTAATGTTCTGAGGCGAGTTCGACATACCAACATTATTCAATTGATTGAAGTATTTGAGTCACAGGAAAGGGTTTATATGGTTATGGAGCTTGCAACAGGTGGGGAACTTTTCGACCGCATTATTGCCAAAGGCTCATTCACTGAAAGGGATGCCACTCATGTATTACAGATGGTTCTGGAAGGTGTGAGATATTTGCATGCACTAGGGATCACTCACAAAGATTTAAAAACTGAAAACCCTCTTTACTATCATCCCTGGTATTGACTCCCAAATTAATGATAACAGATTTTTGGACTTTGCAATGGCTCAAAAAAGGGGGGAATGACTGGTTTAAGGAGGAAAAACCTTGTGGAACACCCAAAAGAAAGTTGCCACCCAAAAGTTTTTACCTAACAAAAACCCCTTAACCCAAACACTCGTTTA
Full Trace Sequence: GAGGGCCCCAATAATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTTGTGGGACGAGTAAAGTTCTCCCTGAACCTTCAAAAAACCTCCAGCTGGACTTGGTGAAAAAAGTGGAACCTTGTTTGGACTCAAAAAGTGACCAATATAATACTTTTATCACAGACACAAGCCAGACATTTGTAAAGGATGATTACCTATGTCACTCATTGCAGAATGGCGACTCAAAGTGTCATGTGGAAAGTACTCACTTAAGGAGACATAAAATTGCTAAGTACAGGGCTAAGTTTGACCCACGTGTAACTGCAAAATATGACATAAAAGCTCTTATTGGACGAGGTAGTTTCAGTCGTGTTGTAAGAGTAGAACATAAGGCCTCTAAACAGCCGTATGCTATTAAAATGATTGAAACAAAATACAGAGAAGGCAGGGAGGTGTGTGAATCTGAGCTTAATGTTCTGAGGCGAGTTCGACATACCAACATTATTCAATTGATTGAAGTATTTGAGTCACAGGAAAGGGTTTATATGGTTATGGAGCTTGCAACAGGTGGGGAACTTTTCGACCGCATTATTGCCAAAGGCTCATTCACTGAAAGGGATGCCACTCATGTATTACAGATGGTTCTGGAAGGTGTGAGATATTTGCATGCACTAGGGATCACTCACAAAGATTTAAAAACTGAAAACCCTCTTTACTATCATCCCTGGTATTGACTCCCAAATTAATGATAACAGATTTTTGGACTTTGCAATGGCTCAAAAAAGGGGGGAATGACTGGTTTAAGGAGGAAAAACCTTGTGGAACACCCAAAAGAAAGTTGCCACCCAAAAGTTTTTACCTAACAAAAACCCCTTAACCCAAACACTCGTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTGTGGGACGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839869
dbEST ID: 79657571
Trimmed Sequence: GCCCAGTTCAATGCTACATGCCAAGTACACTATTAATAATTTACACAACTTTCTTACCTCTCCAGAATAGCTGTACTTCCCTTTTAGTATTTGTCTGTATAACCTGGTCCTGTTATCATCTTCAAATGGCATAGTTCCACTTAGAAGAATATAAGAAATGACTCCAAGAGCCCACATGTCTACAGAGTTTGTGTAGGGCTTTCTTAGTAAAACTTCTGGTGCAATATATTCTGGTGTTCCACAGGTTGTCTTCATTAAACAGTCATCCCCCTTTTTTTGAGCACTTGCAAGTCCAAAATCTGTTATCATTATTTTGGAGTCAATACCAGGATGATAGTAAAGAAGGTTTTCAGGTTTTAAATCTCTGTGAGTGATCCCTAGTGCATGCAAATATCTCACACCTTCCAGAACCATCTGTAATACATGAGTGGCATCCCTTTCAGTGAATGAGCCTTTGGCAATAATGCGGTCGAAAAGTTCCCCACCTGTTGCAAGCTCCATAACCATATAAACCCTTTCCTGTGACTCANATACTTCAATCAATTGAATAATGTTGGTATGTCGAACTCGCCTCAAAACATTAAGCTCAGATTCACACACCTCCCTGCCTTCTCTGTATTTTGTTTCAATCTTTTTAATAGCATACGGCTGTTTAAAGGCCTTATGTTCTACTCTTACNACACGACTGAAACTACCTCGTCCAAATAAAAACTTTTATGTCCTAATTTTGCAGTTTTAACCTTGGGGTCAAACTTAACCCCCGGTAA
Full Trace Sequence: GCGAAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCCAGTTCAATGCTACATGCCAAGTACACTATTAATAATTTACACAACTTTCTTACCTCTCCAGAATAGCTGTACTTCCCTTTTAGTATTTGTCTGTATAACCTGGTCCTGTTATCATCTTCAAATGGCATAGTTCCACTTAGAAGAATATAAGAAATGACTCCAAGAGCCCACATGTCTACAGAGTTTGTGTAGGGCTTTCTTAGTAAAACTTCTGGTGCAATATATTCTGGTGTTCCACAGGTTGTCTTCATTAAACAGTCATCCCCCTTTTTTTGAGCACTTGCAAGTCCAAAATCTGTTATCATTATTTTGGAGTCAATACCAGGATGATAGTAAAGAAGGTTTTCAGGTTTTAAATCTCTGTGAGTGATCCCTAGTGCATGCAAATATCTCACACCTTCCAGAACCATCTGTAATACATGAGTGGCATCCCTTTCAGTGAATGAGCCTTTGGCAATAATGCGGTCGAAAAGTTCCCCACCTGTTGCAAGCTCCATAACCATATAAACCCTTTCCTGTGACTCANATACTTCAATCAATTGAATAATGTTGGTATGTCGAACTCGCCTCAAAACATTAAGCTCAGATTCACACACCTCCCTGCCTTCTCTGTATTTTGTTTCAATCTTTTTAATAGCATACGGCTGTTTAAAGGCCTTATGTTCTACTCTTACNACACGACTGAAACTACCTCGTCCAAATAAAAACTTTTATGTCCTAATTTTGCAGTTTTAACCTTGGGGTCAAACTTAACCCCCGGTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCCAGTTCAATGCTACA