ORFeome > psmc1 ORF1 – XORFeome v1.0

psmc1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: psmc1
Gene ID: 950584
Gene Page ID: 950578
ORF Xenbase ID: 17291313

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054287
Original XGC clone length: 1323

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ839325
dbEST ID: 79657027
Trimmed Sequence: ATGGGTCAGAGTCAGAGTGGTGGACATGGCCCAGGAGGTGGTAAAAAAGATGACAAGGATAAGAAGAAGAAATATGAACCACCTGTACCAACTAGAGTGGGCAAGAAGAAAAAGAAAACAAAGGGGCCAGATGCTGCCAGTAAACTTCCTCTTGTAACACCACATACACAGTGTAGGCTGAAGTTACTGAAGTTGGAGAGGATTAAAGATTATCTTCTAATGGAAGAAGAATTCATCAGAAACCAAGAACAAATGAAGCCTCTTGAGGAGAAGCAGGAGGAGGAACGATCAAAAGTAGATGATCTGAGAGGAACTCCCATGTCAGTTGGTACTCTTGAGGAGATAATTGATGATAACCATGCCATTGTATCTACTTCAGTGGGATCTGAGCATTATGTCAGTATTCTCTCCTTTGTGGATAAGGACCTGCTTGAACCAGGATGTTCCGTTTTATTAAACCACAAAGTGCATGCCGTGATTGGGGTACTCATGGATGACACAGATCCATTAGTAACCGTGATGAAAGTGGAAAAAGCTCCTCAGGAGACCTACGCAGATATTGGAGGGCTTGACAACCAAATTCAAGAGATCAAGGAATCTGTGGAACTTCCCCTAACTCACCCAGAATATTATGAGGAGATGGGCATAAAACCTCCCAAAGGAGTCATTCTGTATGGAGCACCGGGCACAGGTAAAACATTGTTTGGCCAAAGCAGTTGCAAATCCGACCTCTGCCACATTTTCTCAAAATTTGTGGGCTTAGAACTTATTTCAAAAATACCCTAGGAAAAAGGGCCCCCAAACTTTGTCCCCAAAAA
Full Trace Sequence: CGGGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTCAGAGTCAGAGTGGTGGACATGGCCCAGGAGGTGGTAAAAAAGATGACAAGGATAAGAAGAAGAAATATGAACCACCTGTACCAACTAGAGTGGGCAAGAAGAAAAAGAAAACAAAGGGGCCAGATGCTGCCAGTAAACTTCCTCTTGTAACACCACATACACAGTGTAGGCTGAAGTTACTGAAGTTGGAGAGGATTAAAGATTATCTTCTAATGGAAGAAGAATTCATCAGAAACCAAGAACAAATGAAGCCTCTTGAGGAGAAGCAGGAGGAGGAACGATCAAAAGTAGATGATCTGAGAGGAACTCCCATGTCAGTTGGTACTCTTGAGGAGATAATTGATGATAACCATGCCATTGTATCTACTTCAGTGGGATCTGAGCATTATGTCAGTATTCTCTCCTTTGTGGATAAGGACCTGCTTGAACCAGGATGTTCCGTTTTATTAAACCACAAAGTGCATGCCGTGATTGGGGTACTCATGGATGACACAGATCCATTAGTAACCGTGATGAAAGTGGAAAAAGCTCCTCAGGAGACCTACGCAGATATTGGAGGGCTTGACAACCAAATTCAAGAGATCAAGGAATCTGTGGAACTTCCCCTAACTCACCCAGAATATTATGAGGAGATGGGCATAAAACCTCCCAAAGGAGTCATTCTGTATGGAGCACCGGGCACAGGTAAAACATTGTTTGGCCAAAGCAGTTGCAAATCCGACCTCTGCCACATTTTCTCAAAATTTGTGGGCTTAGAACTTATTTCAAAAATACCCTAGGAAAAAGGGCCCCCAAACTTTGTCCCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTCAGAGTCAGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839324
dbEST ID: 79657026
Trimmed Sequence: AAGATACAGCCCCTCTGGGGTGCCCTCTTGCTTTTTATAGAGGACATTCTCTTTTGATTTCTTGAAGTCTTCATTGGTGACTTTCATTCTACGCTCTCTTAATGCCATCAGACCAGCTTCAGTGCAAATGGCCTTTATATCTGCTCCAGAGAGGTCATCTTTTGCCAAAATCAAATCATCCAATGTGACATCAGTAGCTAATGTCATTCGGCTGGTATGAATTTGGAAAATTCTTTTCTTTGTCTTCTCATCAGGCAATGGGAACTCAATCTTCCTATCGATTCTGCCTGGTCTGATCAGTGCTGGGTCCAGTGTTTCTATCCTATTTGTTGCCATAATGACTTTGACATCTCCCCGTGAATCAAACCCATCCAACTGATTGAGAAGCTCTAACATTGTTCTCTGGATTTCTCGCTCCCCACCAGAATTGGAATCATATCTCTTTGTACCAATTGCATCAATCTCATCAATAAACACAATGGAGGGCGCATGTTCCTCAGCTACTCTGAACAGCTCTCGGACAAGTTTGGGGCCATCTCCTANGTATTTCTGAATAAGTTCTAAGCCCCACACTCTGAGAAATGTGGCAGAGGTCTGATTTGCAACTGCTTTGGCCAACAATGTTTTAACCTGTGCCAGGTGCTCCATACAGAATGACTCCCTTTTGGAAGGTTTAATGCCCATCTCCTCCTAATAATTCTGGGGTGAAATTTAGGGGGAAGTTTCCACGAAATTCCTTTGAATTTCTTTTGAAATTTTGGGTTGTTCCAGGCCCCT
Full Trace Sequence: CGCGGAAACCGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGATACAGCCCCTCTGGGGTGCCCTCTTGCTTTTTATAGAGGACATTCTCTTTTGATTTCTTGAAGTCTTCATTGGTGACTTTCATTCTACGCTCTCTTAATGCCATCAGACCAGCTTCAGTGCAAATGGCCTTTATATCTGCTCCAGAGAGGTCATCTTTTGCCAAAATCAAATCATCCAATGTGACATCAGTAGCTAATGTCATTCGGCTGGTATGAATTTGGAAAATTCTTTTCTTTGTCTTCTCATCAGGCAATGGGAACTCAATCTTCCTATCGATTCTGCCTGGTCTGATCAGTGCTGGGTCCAGTGTTTCTATCCTATTTGTTGCCATAATGACTTTGACATCTCCCCGTGAATCAAACCCATCCAACTGATTGAGAAGCTCTAACATTGTTCTCTGGATTTCTCGCTCCCCACCAGAATTGGAATCATATCTCTTTGTACCAATTGCATCAATCTCATCAATAAACACAATGGAGGGCGCATGTTCCTCAGCTACTCTGAACAGCTCTCGGACAAGTTTGGGGCCATCTCCTANGTATTTCTGAATAAGTTCTAAGCCCCACACTCTGAGAAATGTGGCAGAGGTCTGATTTGCAACTGCTTTGGCCAACAATGTTTTAACCTGTGCCAGGTGCTCCATACAGAATGACTCCCTTTTGGAAGGTTTAATGCCCATCTCCTCCTAATAATTCTGGGGTGAAATTTAGGGGGAAGTTTCCACGAAATTCCTTTGAATTTCTTTTGAAATTTTGGGTTGTTCCAGGCCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGATACAGCCCCTCTGG