ORFeome > psmc2 ORF1 – XORFeome v1.0

psmc2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: psmc2
Gene ID: 1000023
Gene Page ID: 1000015
ORF Xenbase ID: 17291319

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054143
Original XGC clone length: 1302

Human orthology & disease relationships

NCBI Entrez ID: 5701
Ensembl gene IDs: ENSG00000161057
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 268000,610015

Library Location

Plate ID: GDExl11001
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ839166
dbEST ID: 79656868
Trimmed Sequence: ATGCCTGACTATCTGGGAGCGGACCAGCGGAAGACCAAAGAAGAAGAAAAGGAGGACAAACCTATCCGATCTCTTGATGAAGGAGATATTGCATTGCTGAAAACCTATGGACAAAGCACTTATTCAAGGCAGATCAAGCAGGTAGAGGATGACATACAGCAACTGCTTAAGAAAATCAATGAGCTTACAGGTATTAAGGAGTCTGATACAGGACTTGCTCCTCCAGCACTTTGGGATTTGGCTGCAGATAAACAGACACTGCAGAGTGAACAACCACTTCAAGTAGCAAGATGTACAAAAATAATCAATGCAGACTCAGAGGACCCAAAATACATTATTAATGTAAAACAATTTGCTAAGTTTGTAGTAGACCTCAGTGACCAAGTTGCTCCTACTGATATTGAAGAGGGTATGAGAGTTGGTGTTGACAGGAACAAATACCAGATTCACATCCCTCTCCCTCCAAAGATTGACCCCACAGTAACAATGATGCAGGTAGAGGAGAAACCTGATGTGACATATAGCGATGTTGGAGGTTGCAAGGAACAAATAGAAAAACTGCGGGAAGTTGTGGAAACACCACTGCTTCATCCGGAGAGGTTTGTTAACCTTGGTATTGAGCCTCCCAAGGGAGTACTGCTGTTTGGACCTCCTGGGACTGGCAAAACTCTGTGTGCACGTGCTGTTACCCACAGAAAAAATGCCCGGCTTCATCCCGTGTCATTGGGATCGAAATTTTGTGCCGAAATATGGGGGAAAAGGGGGGCCCGGAATGGGTGGGGTTGAAACTCCTTCCAAAATGGGCCCAAAAAAAAAA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGACTATCTGGGAGCGGACCAGCGGAAGACCAAAGAAGAAGAAAAGGAGGACAAACCTATCCGATCTCTTGATGAAGGAGATATTGCATTGCTGAAAACCTATGGACAAAGCACTTATTCAAGGCAGATCAAGCAGGTAGAGGATGACATACAGCAACTGCTTAAGAAAATCAATGAGCTTACAGGTATTAAGGAGTCTGATACAGGACTTGCTCCTCCAGCACTTTGGGATTTGGCTGCAGATAAACAGACACTGCAGAGTGAACAACCACTTCAAGTAGCAAGATGTACAAAAATAATCAATGCAGACTCAGAGGACCCAAAATACATTATTAATGTAAAACAATTTGCTAAGTTTGTAGTAGACCTCAGTGACCAAGTTGCTCCTACTGATATTGAAGAGGGTATGAGAGTTGGTGTTGACAGGAACAAATACCAGATTCACATCCCTCTCCCTCCAAAGATTGACCCCACAGTAACAATGATGCAGGTAGAGGAGAAACCTGATGTGACATATAGCGATGTTGGAGGTTGCAAGGAACAAATAGAAAAACTGCGGGAAGTTGTGGAAACACCACTGCTTCATCCGGAGAGGTTTGTTAACCTTGGTATTGAGCCTCCCAAGGGAGTACTGCTGTTTGGACCTCCTGGGACTGGCAAAACTCTGTGTGCACGTGCTGTTACCCACAGAAAAAATGCCCGGCTTCATCCCGTGTCATTGGGATCGAAATTTTGTGCCGAAATATGGGGGAAAAGGGGGGCCCGGAATGGGTGGGGTTGAAACTCCTTCCAAAATGGGCCCAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGACTATCTGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839165
dbEST ID: 79656867
Trimmed Sequence: GTTGTAAGTCATGTATCTTGGGGTAGCGCTGAATTTTGCATACGATTTTATGACCTTGTTTACGGCTTCTAAGAAATCTTTCTCCGTTGCAACTTTGCGGCGGGCTCGAATAGCAAACATTCCAGCCTCCGTGCACACGCTACGAATTTCTGCTCCTGTACTGTTAGGACATAGCCGAGCCAGAAGTTCAAATCTTATATCCCTCTCGACACTCATAGAACGTGCGTGAATCTTAAATATGTGTGTACGGCCCTCTAGATCTGGCAAACTAAATTCAATTTTTCTGTCCAGTCTTCCAGGCCTCATAAGAGCAGGATCCAAAGTGTCGGGTCTGTTAGTGGCCATTAACACTTTAATGTTTCCTCTGGGATCAAAGCCATCCAACTGGTTGATTAGTTCTAGCATAGTGCGCTGAACTTCATTATCACCCCCAGCTCCATCATCAAAACGAGCCCCACCAATGGCGTCAATTTCATCAAAGAAAATAAGACATGCTTTTTTTGTTCTGGCCATCTCGAAGAGTTCACGCACCATACGGGCCCCCTCTCCCACATATTTCTGCACAAGTTCAGATCCAATGACACGGATGAAGCAGGCATCTGTTCTGTTGGCTACGGCACGTGCACACCGAGTTTTTGCCAGTCCCCGGAGGTTCCAAACACCAGAACTCCCTTTGGGAAGCTTCAAAACCAAGGTAAACAAACCCTCCTCCGGATGAAAGCCAGGGGGGGTTTCCCCCAACTTTCCCCCGCAAATTTTTTTCCAAATTG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGTAAGTCATGTATCTTGGGGTAGCGCTGAATTTTGCATACGATTTTATGACCTTGTTTACGGCTTCTAAGAAATCTTTCTCCGTTGCAACTTTGCGGCGGGCTCGAATAGCAAACATTCCAGCCTCCGTGCACACGCTACGAATTTCTGCTCCTGTACTGTTAGGACATAGCCGAGCCAGAAGTTCAAATCTTATATCCCTCTCGACACTCATAGAACGTGCGTGAATCTTAAATATGTGTGTACGGCCCTCTAGATCTGGCAAACTAAATTCAATTTTTCTGTCCAGTCTTCCAGGCCTCATAAGAGCAGGATCCAAAGTGTCGGGTCTGTTAGTGGCCATTAACACTTTAATGTTTCCTCTGGGATCAAAGCCATCCAACTGGTTGATTAGTTCTAGCATAGTGCGCTGAACTTCATTATCACCCCCAGCTCCATCATCAAAACGAGCCCCACCAATGGCGTCAATTTCATCAAAGAAAATAAGACATGCTTTTTTTGTTCTGGCCATCTCGAAGAGTTCACGCACCATACGGGCCCCCTCTCCCACATATTTCTGCACAAGTTCAGATCCAATGACACGGATGAAGCAGGCATCTGTTCTGTTGGCTACGGCACGTGCACACCGAGTTTTTGCCAGTCCCCGGAGGTTCCAAACACCAGAACTCCCTTTGGGAAGCTTCAAAACCAAGGTAAACAAACCCTCCTCCGGATGAAAGCCAGGGGGGGTTTCCCCCAACTTTCCCCCGCAAATTTTTTTCCAAATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTAAGTCATGTATCTTGGGGT