ORFeome > psmc3ip ORF1 – XORFeome v1.0

psmc3ip ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: psmc3ip
Gene ID: 987673
Gene Page ID: 987669
ORF Xenbase ID: 17291331

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082900
Original XGC clone length: 645

Human orthology & disease relationships

NCBI Entrez ID: 29893
Ensembl gene IDs: ENSG00000131470
Directly associated (OMIM) disease MIM numbers: 614324
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ839681
dbEST ID: 79657383
Trimmed Sequence: ATGAGCAAGTCCAAGGAAGCGGCTGCTAGCAGCATTATTCTGAAATATCTCAATGATCAGAACAGACCTTACAGCACCCAGGATGTGTTCAGTAACCTGCAAAGGGATCACGGTCTAGGAAAAACGGCAGTTGTCAAGACCATGGAGTTGCTGGCTCAAAAAGGGAAGATCAAGGAGAAAGTTTATGGAAAACAGAAAATCTACTTTGCAGATCAGGAGCAGTTTCCAAGCGTTAGTGACTCAGAGCTTAAGGATCTCGATGCCCAAGTCACAGAACTTTCTAGCAAACTGCAGAGTTCTCAGCAGAGCTGCCGCCAGCTGGAGTCAGAGCTGAAAGATTTGACCAGCTCCTTAACCACAGAGGAGATGCTAAAAGAAGTCTCTTGCTTAAAGGAAGAATGTGACAGACATGAGCACAAACTGACAAACATAAAGTCTGCCACGAATCACGTTACTCCTGCAGAAAAAGAAAAGGTCTACGGTGAGCGAAAACATTTCTGCAAAGAATGGAAAAAGAGAAAACGGATGGCAACAGACATTTTTGATGCAATTCTTGAAGGATATCCCAAAAGCAAGAAGCAGTTTTTTGAGGAAGTTGGAGTTGAGACAGATGAAGACTGCAATGTGACCGTGCCAGATGTGTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCAAGTCCAAGGAAGCGGCTGCTAGCAGCATTATTCTGAAATATCTCAATGATCAGAACAGACCTTACAGCACCCAGGATGTGTTCAGTAACCTGCAAAGGGATCACGGTCTAGGAAAAACGGCAGTTGTCAAGACCATGGAGTTGCTGGCTCAAAAAGGGAAGATCAAGGAGAAAGTTTATGGAAAACAGAAAATCTACTTTGCAGATCAGGAGCAGTTTCCAAGCGTTAGTGACTCAGAGCTTAAGGATCTCGATGCCCAAGTCACAGAACTTTCTAGCAAACTGCAGAGTTCTCAGCAGAGCTGCCGCCAGCTGGAGTCAGAGCTGAAAGATTTGACCAGCTCCTTAACCACAGAGGAGATGCTAAAAGAAGTCTCTTGCTTAAAGGAAGAATGTGACAGACATGAGCACAAACTGACAAACATAAAGTCTGCCACGAATCACGTTACTCCTGCAGAAAAAGAAAAGGTCTACGGTGAGCGAAAACATTTCTGCAAAGAATGGAAAAAGAGAAAACGGATGGCAACAGACATTTTTGATGCAATTCTTGAAGGATATCCCAAAAGCAAGAAGCAGTTTTTTGAGGAAGTTGGAGTTGAGACAGATGAAGACTGCAATGTGACCGTGCCAGATGTGTTGCCNACTTTCTTGTANCAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCATCCAGCTGATTCCCCCCTATAGTGAATCATATTAACAATGGGCAAAACCTAATTTCCGGACAGCTCCGGCCGGTCGCGCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAAGTCCAAGGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839680
dbEST ID: 79657382
Trimmed Sequence: CACATCTGGCACGGTCACATTGCAGTCTTCATCTGTCTCAACTCCAACTTCCTCAAAAAACTGCTTCTTGCTTTTGGGATATCCTTCAAGAATTGCATCAAAAATGTCTGTTGCCATCCGTTTTCTCTTTTTCCATTCTTTGCAGAAATGTTTTCGCTCACCGTAGACCTTTTCTTTTTCTGCAGGAGTAACGTGATTCGTGGCAGACTTTATGTTTGTCAGTTTGTGCTCATGTCTGTCACATTCTTCCTTTAAGCAAGAGACTTCTTTTAGCATCTCCTCTGTGGTTAAGGAGCTGGTCAAATCTTTCAGCTCTGACTCCAGCTGGCGGCAGCTCTGCTGAGAACTCTGCAGTTTGCTAGAAAGTTCTGTGACTTGGGCATCGAGATCCTTAAGCTCTGAGTCACTAACGCTTGGAAACTGCTCCTGATCTGCAAAGTAGATTTTCTGTTTTCCATAAACTTTCTCCTTGATCTTCCCTTTTTGAGCCAGCAACTCCATGGTCTTGACAACTGCCGTTTTTCCTAGACCGTGATCCCTTTGCAGGTTACTGAACACATCCAGGGTGCTGTAAGGTCTGTTCTGAACATTGAGATATTTCAAAACAAAGCTGCTAGCAGCCGCCTCCTTGGAATTGCTCAAGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACATCTGGCACGGTCACATTGCAGTCTTCATCTGTCTCAACTCCAACTTCCTCAAAAAACTGCTTCTTGCTTTTGGGATATCCTTCAAGAATTGCATCAAAAATGTCTGTTGCCATCCGTTTTCTCTTTTTCCATTCTTTGCAGAAATGTTTTCGCTCACCGTAGACCTTTTCTTTTTCTGCAGGAGTAACGTGATTCGTGGCAGACTTTATGTTTGTCAGTTTGTGCTCATGTCTGTCACATTCTTCCTTTAAGCAAGAGACTTCTTTTAGCATCTCCTCTGTGGTTAAGGAGCTGGTCAAATCTTTCAGCTCTGACTCCAGCTGGCGGCAGCTCTGCTGAGAACTCTGCAGTTTGCTAGAAAGTTCTGTGACTTGGGCATCGAGATCCTTAAGCTCTGAGTCACTAACGCTTGGAAACTGCTCCTGATCTGCAAAGTAGATTTTCTGTTTTCCATAAACTTTCTCCTTGATCTTCCCTTTTTGAGCCAGCAACTCCATGGTCTTGACAACTGCCGTTTTTCCTAGACCGTGATCCCTTTGCAGGTTACTGAACACATCCAGGGTGCTGTAAGGTCTGTTCTGAACATTGAGATATTTCAAAACAAAGCTGCTAGCAGCCGCCTCCTTGGAATTGCTCAAGGTGCCCACTTTGTTGTAAAAAATTGGCATTATAAAAAAACATTGCTTATCAAGTTTGTTTCAACCAAACAGGATAAAAAAAAAATAAAAAAAAAAAAAAAAAAAATAACCATAACGAAACGTAAAAAACGGGACCGATCATTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATCTGGCACGGTCACATT