ORFeome > psmg1 ORF1 – XORFeome v1.0

psmg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: psmg1
Gene ID: 866332
Gene Page ID: 494235
ORF Xenbase ID: 17291481

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123192
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ838341
dbEST ID: 79656043
Trimmed Sequence: ATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATGAGGAGGAAGAGGATGAAGACGACGACGAGGAAGAAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCGGCTGGAACACCCAATATACTGGATGGGCTTCCTGCTGCAGTGCTGTCCCCTTGTCAGGTATTGGGGAATCCCCGCCGGTCTTTCTCCAGTTGCTACCCGAATATCCTCCCAACTGGAATTCCGGCCCCTATTTAAGGGGTTTTCCGAACCCCCTTCCCAACCCCGTTGGGAACACCTTGAGGCCGAATGGGGCGTCCGCGAACC
Full Trace Sequence: TCGTGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACGTTCTTCGGGGAAGTGCAGTCCGTGTTCTCCAGAGCTGTGGATGAGGAGGAAGAGGATGAAGACGACGACGAGGAAGAAGAAGAAGACAGAGAGATCATTGCGGAGCTGGAGAGGAAGAGGGAGGTGCGTGTGACATGGAACCCTGAGCTCACAGCAGCCATTGAAAGCTCTCCTGGCAAAAGGCTCCCCTGCTCCAGTGTCATCTTGTCTGTCGGTGACAATGCAACAGGGTTTGTATCTTCCTACATACTGAGCTCTGGCAGTTGGGAAGTGGCTGGATCTGTCACACTGTGGAACGAGAGATGCAGAGACTGCAACGTCAGAAAAGATTTTCTCCCTGCTCCCTCTTCTTGTACCTTTTACAGGTCCATTACAGACCCCACGGTCCTGCTGTGCCAGTGCAACTGTCATGTGGCAGAAGACCAGCTGTTCCAGTGGTGCGAGAAGGTATTTGGCTCACTGGAAAAGAGCAGCCTAAAAGTAACGGTCCTTTCTACCTGCCCGGTTTCTGAATATAAAACCCCAGAGTCCACGTACAGTCTCCCTGTTCCCTTCTTGAAAGCACTGAGGACTAGCGAGTACAGAGAGGAGGTGCCGTGCCCCCGGCTGGAACACCCAATATACTGGATGGGCTTCCTGCTGCAGTGCTGTCCCCTTGTCAGGTATTGGGGAATCCCCGCCGGTCTTTCTCCAGTTGCTACCCGAATATCCTCCCAACTGGAATTCCGGCCCCTATTTAAGGGGTTTTCCGAACCCCCTTCCCAACCCCGTTGGGAACACCTTGAGGCCGAATGGGGCGTCCGCGAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACGTTCTTCGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838340
dbEST ID: 79656042
Trimmed Sequence: GATGTAAAGGTTACTCTGAATCTCGTTCAATTTCACCGTCTTTCTCAAAGTTTCTTGGATATTTGCAGAGTCCGCAGCCAATCGGCTCAGGCTTCCACTGGATAGGAGGGGTCGGAAAGCCTTAATAGTGACAGAATCCAGTTTGGAGATATCCGTGTAGCACTGGTAGAAGACAGCGGGGATTCCCAATACCTGACAATGGGACAGCACTGCAGCAGGAAGCCCATCCACTATATTGGGCTGTTCCAGCAGGGGGCACGGCACCTCCTCTCTGTACTCGCTAGTCCTCAGTGCTTTCAAGAAGGGAACAGGGAGACTGTACGTGGACTCTGGGGTTTTATATTCAAAAACCGGGCAGGTAGAAAGGACCGTTACTTTTAGGCTGCTCTTTTCCAGTGAGCCAAATACCTTCTCGCACCACTGGAACAGCTGGTCTTCTGCCACATGACAGTTGCACTGGCACAGCAGGACCGTGGGGTCTGTAATGGACCTGTAAAAGGTACAGAAAAGGGGGCAGGGAGAAAATCTTTTCTGACGTTGCAGTCTCTGCATCTCTCCGTTCCCCAGGTGACAGAACCAGGCCACTTTCCAACTGGCCGAAACTCATTAAGTTGGAAGATAAAAACCCCTGTTGCATTGGTCCCCAAAGAACAAAAGGAAACTGGAAGAAAGGGAAACCCTTTTGGCAGGGAAAACCTTTTCAAGTGGGCGTGGGTGTAAGCGTCAGGGGTTTTCCTGTTTCCAAAACCCCCCACCCTTCCCT
Full Trace Sequence: CGGGAATCAGGCTATGACCATGTAATACGACTCACTATAGAGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGTAAAGGTTACTCTGAATCTCGTTCAATTTCACCGTCTTTCTCAAAGTTTCTTGGATATTTGCAGAGTCCGCAGCCAATCGGCTCAGGCTTCCACTGGATAGGAGGGGTCGGAAAGCCTTAATAGTGACAGAATCCAGTTTGGAGATATCCGTGTAGCACTGGTAGAAGACAGCGGGGATTCCCAATACCTGACAATGGGACAGCACTGCAGCAGGAAGCCCATCCACTATATTGGGCTGTTCCAGCAGGGGGCACGGCACCTCCTCTCTGTACTCGCTAGTCCTCAGTGCTTTCAAGAAGGGAACAGGGAGACTGTACGTGGACTCTGGGGTTTTATATTCAAAAACCGGGCAGGTAGAAAGGACCGTTACTTTTAGGCTGCTCTTTTCCAGTGAGCCAAATACCTTCTCGCACCACTGGAACAGCTGGTCTTCTGCCACATGACAGTTGCACTGGCACAGCAGGACCGTGGGGTCTGTAATGGACCTGTAAAAGGTACAGAAAAGGGGGCAGGGAGAAAATCTTTTCTGACGTTGCAGTCTCTGCATCTCTCCGTTCCCCAGGTGACAGAACCAGGCCACTTTCCAACTGGCCGAAACTCATTAAGTTGGAAGATAAAAACCCCTGTTGCATTGGTCCCCAAAGAACAAAAGGAAACTGGAAGAAAGGGAAACCCTTTTGGCAGGGAAAACCTTTTCAAGTGGGCGTGGGTGTAAGCGTCAGGGGTTTTCCTGTTTCCAAAACCCCCCACCCTTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTAAAGGTTACTCTGAATCTC