ORFeome > psmg2 ORF1 – XORFeome v1.0

psmg2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: psmg2
Gene ID: 1003813
Gene Page ID: 1003807
ORF Xenbase ID: 17291487

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054255
Original XGC clone length: 780

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ839429
dbEST ID: 79657131
Trimmed Sequence: ATGTTCGTACCGGTGGGATCTGAGCAGGATTTTCCGAGTGTTTCTACTCTGCTGCTGCCAGCCATATCAGTTGGAAATGTTGGGCAGCTAGCCATTGATTTGATTATTTCAACACTGAACATCCCGAAAGTGGGGTATTTTTACACAGACTGCCTTGTACCTATGGTGGGAAACAATCCATATGAAACCAATGAAGAAAACGCTAAGGAACTGTGTACAAATGCTGAAGTGTATGCACTGCCATCCCAGAAACTTGCAGTTCTCCAGCTAAGATCACTTGTTATAAAGAAAAAATCCAAATCCTTCCGGCAAGCCCTGGTTTCCTGGATTAAAAGATGTGCATTTGCCCGAGTGATTTTTCTCTCAAGTTGCCATGCTTATCACAGGGATGATAAACAGCTTTTTGGAACGCCATTCCGTTACTTGGTCACTCCAGCTTTACAGAAATCTGTGGCAGATGTGCTAAGTGAACTGGAATGGAAGGAAATGGAAAAAGTGTCTTCTTACCCAGAGCTGAATGATAACGAGAAAAAGCTTTTCATTCCAGGAGGAGGATTCACGAAGGCATTTTATAATGATTGTTGTTTAGAAAACCTGCAGATGGCTGTTGTGGTTAAGATTCTGTTCTGATGGTGAACACGTACCCCGATGCCTTCTCTCTTCTTAATCCAGTCAATTGATTGGCTTCCATTTGGTAAAAACCCACAAATGGGGAATTTCAAGGTGGAAAGTGCCCTAAGAATCCTGGCCGGTTTTCTGGTTTTGGGAAGGGGGTTTTCCCGCCCCCGGGCACCCCTTTTA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCGTACCGGTGGGATCTGAGCAGGATTTTCCGAGTGTTTCTACTCTGCTGCTGCCAGCCATATCAGTTGGAAATGTTGGGCAGCTAGCCATTGATTTGATTATTTCAACACTGAACATCCCGAAAGTGGGGTATTTTTACACAGACTGCCTTGTACCTATGGTGGGAAACAATCCATATGAAACCAATGAAGAAAACGCTAAGGAACTGTGTACAAATGCTGAAGTGTATGCACTGCCATCCCAGAAACTTGCAGTTCTCCAGCTAAGATCACTTGTTATAAAGAAAAAATCCAAATCCTTCCGGCAAGCCCTGGTTTCCTGGATTAAAAGATGTGCATTTGCCCGAGTGATTTTTCTCTCAAGTTGCCATGCTTATCACAGGGATGATAAACAGCTTTTTGGAACGCCATTCCGTTACTTGGTCACTCCAGCTTTACAGAAATCTGTGGCAGATGTGCTAAGTGAACTGGAATGGAAGGAAATGGAAAAAGTGTCTTCTTACCCAGAGCTGAATGATAACGAGAAAAAGCTTTTCATTCCAGGAGGAGGATTCACGAAGGCATTTTATAATGATTGTTGTTTAGAAAACCTGCAGATGGCTGTTGTGGTTAAGATTCTGTTCTGATGGTGAACACGTACCCCGATGCCTTCTCTCTTCTTAATCCAGTCAATTGATTGGCTTCCATTTGGTAAAAACCCACAAATGGGGAATTTCAAGGTGGAAAGTGCCCTAAGAATCCTGGCCGGTTTTCTGGTTTTGGGAAGGGGGTTTTCCCGCCCCCGGGCACCCCTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCGTACCGGTGGGATCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839428
dbEST ID: 79657130
Trimmed Sequence: GAAGATGGCAGGAGGCAAACCACTACCAAACAGCAACCGCCAGGATCTAGGTGACTTCCATTTGACATCACCATTTGTTGGCTCTACCAAATGAAGCCACTCATTGACTTGATTAAGAAGAGAGAAGGCATCGGGTACGTTGTCACCTTCAGAACAGAATTTTAACACAACAGCCATCTGCAGGTCTTCTAAACAACAATCATTATAAAATGCCTTCGTGAATCCTCCTCCTGGAATGAAAAGCTTTTTCTCGTTATCATTCAGCTCTGGGTAAGAAGACACTTTTTCCATTTCCTTCCATTCCAGTTCACTTAGCACATCTGCCACAGATTTCTGTAAAGCTGGAGTGACCAAGTAACGGAATGGCGTTCCAAAAAGCTGTTTATCATCCCTGTGATAAGCATGGCAACTTGAGAGAAAAATCACTCGGGCAAATGCACATCTTTTAATCCAGGAAACCAGGGCTTGCCGGAAGGATTTGGATTTTTTCTTTATAACAAGTGATCTTAGCTGGAGAACTGCAAGTTTCTGGGATGGCAGTGCATACACTTCAGCATTTGTACACAGTTCCTTAACGTTTTCTTCCTTGCTTTCAGATGGATTGTTTCCCACCATAGGTACCAAGAAGTCGGTGTAAAAATACCCCCTTTTCCGGAAGTTCAGTGGTTAAGTAATCAAATCGATGGGGTAGCTGCCCCACCTTTTCCACCTGAATAAGGCCTGGCGCCAACCGAAGTGAAAAACCCCCGGAAAAAAACCTCGCTAGAAATC
Full Trace Sequence: AACGGTCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGATGGCAGGAGGCAAACCACTACCAAACAGCAACCGCCAGGATCTAGGTGACTTCCATTTGACATCACCATTTGTTGGCTCTACCAAATGAAGCCACTCATTGACTTGATTAAGAAGAGAGAAGGCATCGGGTACGTTGTCACCTTCAGAACAGAATTTTAACACAACAGCCATCTGCAGGTCTTCTAAACAACAATCATTATAAAATGCCTTCGTGAATCCTCCTCCTGGAATGAAAAGCTTTTTCTCGTTATCATTCAGCTCTGGGTAAGAAGACACTTTTTCCATTTCCTTCCATTCCAGTTCACTTAGCACATCTGCCACAGATTTCTGTAAAGCTGGAGTGACCAAGTAACGGAATGGCGTTCCAAAAAGCTGTTTATCATCCCTGTGATAAGCATGGCAACTTGAGAGAAAAATCACTCGGGCAAATGCACATCTTTTAATCCAGGAAACCAGGGCTTGCCGGAAGGATTTGGATTTTTTCTTTATAACAAGTGATCTTAGCTGGAGAACTGCAAGTTTCTGGGATGGCAGTGCATACACTTCAGCATTTGTACACAGTTCCTTAACGTTTTCTTCCTTGCTTTCAGATGGATTGTTTCCCACCATAGGTACCAAGAAGTCGGTGTAAAAATACCCCCTTTTCCGGAAGTTCAGTGGTTAAGTAATCAAATCGATGGGGTAGCTGCCCCACCTTTTCCACCTGAATAAGGCCTGGCGCCAACCGAAGTGAAAAACCCCCGGAAAAAAACCTCGCTAGAAATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGATGGCAGGAGGCAA