ORFeome > ptafr ORF1 – XORFeome v1.0

ptafr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ptafr
Gene ID: 968930
Gene Page ID: 968924
ORF Xenbase ID: 17291511

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046657
Original XGC clone length: 1065

Human orthology & disease relationships

NCBI Entrez ID: 5724
Ensembl gene IDs: ENSG00000169403
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 142623,176410,277580

Library Location

Plate ID: GDExl11010
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ823820
dbEST ID: 79641522
Trimmed Sequence: ATGTCTTCAGAGGCACCTACAGTCTACCTAAGTAAAACAGATCCTTGCGATGTGGTGGATTCCCCTTTCAGATACTCCCTCTTCACTGTGACCTACAGCATCATTTTTGTCTTCGGCTTTATCGCCAACTGTTACGTCTTGTGGATATTTGGCCGCGTTTACCCTGCCAAGAATCTCAGTGAAATTAAAATATTTATGATCAATTTGACAATTGCAGACTTGCTGTTTTTAGTAACGCTTCCACTGTGGATTGTTTATTACCATTATGAAGGGGACTGGTTTATGCCTTCCTTTCTTTGCAATGTGGCTGGCTGTTTTTTTTTCCTCAACACATATTGTTCCGTGGCATTTCTTGGAGTCATAAGCTATAACCGATTCCAGGCTGTAACACGTCCGGTAGAAACTGCTCAGTCCACAGCAAGAATCAGAGGCATTTGCATCTCAGTAGCTGTATGGATCCTTTTGTTTGCCAGCTCATTATATTTTCTTATTTTTCCTGGCACTAATATAGTGAACATTGATGGCAAAAATTTCACCAGATGCTTTGAAGGATACAGTATTGACAACAGAGAACCAGTGGCTGTTATACACTTTATACTGGTTGGGGCATTTTTTGTGGTGTTTCTCATCATATTAACCTGCAATTTGGTGATTGCCAGAACCTTACTTTACCAGCCAGTGAAGTCGAGGAAAAGTTCAGACATGAAGCATAAAGCTTTTGTGGGATGGTGGTCACTGTACTTGCCAGTCTTTTGTCCTATGCTTTGTGGCCCCACCCTAATTGTAAAATAGCCCTTGGGACTCTTAACAAAATTTTGAAAAGGTGGGGAGGGAAACAAAAATTGTGGATTT
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTCAGAGGCACCTACAGTCTACCTAAGTAAAACAGATCCTTGCGATGTGGTGGATTCCCCTTTCAGATACTCCCTCTTCACTGTGACCTACAGCATCATTTTTGTCTTCGGCTTTATCGCCAACTGTTACGTCTTGTGGATATTTGGCCGCGTTTACCCTGCCAAGAATCTCAGTGAAATTAAAATATTTATGATCAATTTGACAATTGCAGACTTGCTGTTTTTAGTAACGCTTCCACTGTGGATTGTTTATTACCATTATGAAGGGGACTGGTTTATGCCTTCCTTTCTTTGCAATGTGGCTGGCTGTTTTTTTTTCCTCAACACATATTGTTCCGTGGCATTTCTTGGAGTCATAAGCTATAACCGATTCCAGGCTGTAACACGTCCGGTAGAAACTGCTCAGTCCACAGCAAGAATCAGAGGCATTTGCATCTCAGTAGCTGTATGGATCCTTTTGTTTGCCAGCTCATTATATTTTCTTATTTTTCCTGGCACTAATATAGTGAACATTGATGGCAAAAATTTCACCAGATGCTTTGAAGGATACAGTATTGACAACAGAGAACCAGTGGCTGTTATACACTTTATACTGGTTGGGGCATTTTTTGTGGTGTTTCTCATCATATTAACCTGCAATTTGGTGATTGCCAGAACCTTACTTTACCAGCCAGTGAAGTCGAGGAAAAGTTCAGACATGAAGCATAAAGCTTTTGTGGGATGGTGGTCACTGTACTTGCCAGTCTTTTGTCCTATGCTTTGTGGCCCCACCCTAATTGTAAAATAGCCCTTGGGACTCTTAACAAAATTTTGAAAAGGTGGGGAGGGAAACAAAAATTGTGGATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTCAGAGGCACCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ829128
dbEST ID: 79646830
Trimmed Sequence: TACACTGGTAACATTGTCTATCTTTTCTTTGAATGGCAATATGGTCTCTACGTTGGTGTCAGTCGTATTTCTGGACAACTTACGGCTGCTTTTAATGTTCTGGATTCGCTCACTGAGATGTTTCCTGAACTTCTTTGTGAGGAAACAATAGATGATTGGGTCCAGCATGCAGTTGGTGCTCATAAGACACAGTGTTATTTGATGCACATTATTTAGCATTTTTCGGAAATCACAATCTGTTTCATGCCACATTCTCAATACTGTTAGAGTCCAAGGGCCATCTACAATATGGTGAGGCACAAAGCATAGGACAAAGACTGCAAGTACAGTGACCACCATCCACAAAGCTCTATGCTTCATGTCTGAACTTTTCCTCGACTTCACTGGCTGGTAAAGTAAGGTTCTGGCAATCACCAAATTGCAGGTTAATATGATGAGAAACACCACAAAAAATGCCCCAACCAGTATAAAGTGTATAACAGCCACTGGTTCTCTGTTGTCAATACTGTATCCTTCAAAGCATCTGGTGAAATTTTTGCCATCAATGTTCACTATATTAGTGCCAGGAAAAATAAGAAAATATAATGAGCTGGCAAACAAAAGGATCCATACAGCTACTGAGATGCAAATGCCTCTGATTCTTGCTGTGGACTGAGCAGTTTTCTACCGGACGTGTTACAGCCCTGGAAATCGGTATAGGCTTATGACTCCAAAAAAATGCACCGGAAACCATAATGTGGTTGAGGAAAAAAAAAACAGCCCCGGCCACAATTTCAAA
Full Trace Sequence: CGGGTAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACACTGGTAACATTGTCTATCTTTTCTTTGAATGGCAATATGGTCTCTACGTTGGTGTCAGTCGTATTTCTGGACAACTTACGGCTGCTTTTAATGTTCTGGATTCGCTCACTGAGATGTTTCCTGAACTTCTTTGTGAGGAAACAATAGATGATTGGGTCCAGCATGCAGTTGGTGCTCATAAGACACAGTGTTATTTGATGCACATTATTTAGCATTTTTCGGAAATCACAATCTGTTTCATGCCACATTCTCAATACTGTTAGAGTCCAAGGGCCATCTACAATATGGTGAGGCACAAAGCATAGGACAAAGACTGCAAGTACAGTGACCACCATCCACAAAGCTCTATGCTTCATGTCTGAACTTTTCCTCGACTTCACTGGCTGGTAAAGTAAGGTTCTGGCAATCACCAAATTGCAGGTTAATATGATGAGAAACACCACAAAAAATGCCCCAACCAGTATAAAGTGTATAACAGCCACTGGTTCTCTGTTGTCAATACTGTATCCTTCAAAGCATCTGGTGAAATTTTTGCCATCAATGTTCACTATATTAGTGCCAGGAAAAATAAGAAAATATAATGAGCTGGCAAACAAAAGGATCCATACAGCTACTGAGATGCAAATGCCTCTGATTCTTGCTGTGGACTGAGCAGTTTTCTACCGGACGTGTTACAGCCCTGGAAATCGGTATAGGCTTATGACTCCAAAAAAATGCACCGGAAACCATAATGTGGTTGAGGAAAAAAAAAACAGCCCCGGCCACAATTTCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACACTGGTAACATTGTCTATCTT