ORFeome > ptar1 ORF1 – XORFeome v1.0

ptar1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ptar1
Gene ID: 5829656
Gene Page ID: 5829624
ORF Xenbase ID: 17291517

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123230
Original XGC clone length: 1299

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ838233
dbEST ID: 79655935
Trimmed Sequence: ATGGCGGAGTGGAAGGAGGAGGTGGAGGTGCTGGTCCAGCGAGTGGTGAAGGACATCACTGGCGCCTTCCGCAGGAACCCCAATATAGATGAAATCGGATTAATCCCGTGCCCTGAGGCGAAGTATAATCGTAGCCCTATAGTTTTAGTAGAAAACAAGCTGGGTGTGGAGAGCTGGTGCATCAAGTTTCTTCTTCCATATGTACACAATAAGCTTCTCCTATACCGCCAGAAAAAACTTTGGCTTAACAGGGATGAATTGATCGATGTTACCTGCACGCTGCTTTTGCTGAACCCAGATTTCACTACAGCATGGAATGTAAGGAAAGAGTTAATACAGTCTGGAACCTTGAACCCAGTTAAAGATTTACAGCTTGGAAAACTGGCATTGACTAAGTTTCCAAAGAGCCCAGAGACATGGATACACAGGCGCTGGGCATTGCAACGTCTTGTGCAGGAATTAGTTGTGGCCGCTGTTGTGGACAAGGATGCCATCTGTCCTGAGACCTCTGAGAGGATCCAAGCTATTGTGGAGGAAGAAATGCATGTTTGCTGTGAGGCTGCTGGAAGATACCCAAGTAACTATAATTCCTGGTCCCATCGCATCTGGGTTGTACAGCACCTTGGAAATTTAAAAGCTACGCTCCTGATCAATGAGCTGTCTTCCATCCAACACTGGGTCTCCATGCATGTTTCAGACCATAATGGATTTCATTATCCTCCGTTTCCTGTTGAAGTCCCCTCCTGAGTTAAAACCTCTAAGGAACTTTTAAATATTGTGGGGAGACTTTCCCAGGAACCCTAATTTGCAAATGAGA
Full Trace Sequence: CGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGTGGAAGGAGGAGGTGGAGGTGCTGGTCCAGCGAGTGGTGAAGGACATCACTGGCGCCTTCCGCAGGAACCCCAATATAGATGAAATCGGATTAATCCCGTGCCCTGAGGCGAAGTATAATCGTAGCCCTATAGTTTTAGTAGAAAACAAGCTGGGTGTGGAGAGCTGGTGCATCAAGTTTCTTCTTCCATATGTACACAATAAGCTTCTCCTATACCGCCAGAAAAAACTTTGGCTTAACAGGGATGAATTGATCGATGTTACCTGCACGCTGCTTTTGCTGAACCCAGATTTCACTACAGCATGGAATGTAAGGAAAGAGTTAATACAGTCTGGAACCTTGAACCCAGTTAAAGATTTACAGCTTGGAAAACTGGCATTGACTAAGTTTCCAAAGAGCCCAGAGACATGGATACACAGGCGCTGGGCATTGCAACGTCTTGTGCAGGAATTAGTTGTGGCCGCTGTTGTGGACAAGGATGCCATCTGTCCTGAGACCTCTGAGAGGATCCAAGCTATTGTGGAGGAAGAAATGCATGTTTGCTGTGAGGCTGCTGGAAGATACCCAAGTAACTATAATTCCTGGTCCCATCGCATCTGGGTTGTACAGCACCTTGGAAATTTAAAAGCTACGCTCCTGATCAATGAGCTGTCTTCCATCCAACACTGGGTCTCCATGCATGTTTCAGACCATAATGGATTTCATTATCCTCCGTTTCCTGTTGAAGTCCCCTCCTGAGTTAAAACCTCTAAGGAACTTTTAAATATTGTGGGGAGACTTTCCCAGGAACCCTAATTTGCAAATGAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGTGGAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838232
dbEST ID: 79655934
Trimmed Sequence: GTGACCTTGCAAAGAGAGTAGCCATTTTCTGTATGAAGCAGCAAACCTGGACTGCTCAGGGCTACAGCAGTTGGTTAAGACACAGTTGATGAACCTGAGCTCAGAATCAAAGCTAAGCGAGTCTTGTACAGGGGCACGCTTTAGACGTTTTATCTCCTGTGTGTAGCCTTGTTTGTTGGGATCACTCATTCCATCTATATCCATAGGGTTAGTGACATAGCTCTGGAAGGTGGTGCTCATCTGTGAAATGTTTCCACTGCCATCAGGGATGCTCGCACTTGTGGACTGTGGAGTGGCTGATTCACTTTGTTCGTGGAGTAGCTGATGAATCGGGTTGAGTATCTGGCACCTATCACACCAAATGTTTCAATGCCAGCCAAGGAAGCGCGGGCTCGCCGCTGAGTGGGGGGCTTCTTCTCTGGAAAAGAGGAGGAAAAAGGAAACTTTCGCGGGGCCCGTGCAAACGACCCCAATAAGAAAGAGAAAAAAAATCTGTGTTGGGGAGGGGGCGGGCGACACACCCAATAACTAATATTCTTGGGGCGGTCCCCCATGGAGGGCTACCGCGCAGAGAAGATAAAACAAACCCCTGTTAGGATAAGAAGGGCGCGGCAACCCCAGGGGGGGGGCGCGGAGCGGTCGGCACAAAAAAGGAGGTTTTACTTTAATTTCCTCGGGGGGGGGGGCGCACCCCCAAAAAGCGGGGAGGAGAACTAAGGAAATTTGTGGGGGGGGGGGGGACGCCCCCAGGGCGGACGAGG
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGACCTTGCAAAGAGAGTAGCCATTTTCTGTATGAAGCAGCAAACCTGGACTGCTCAGGGCTACAGCAGTTGGTTAAGACACAGTTGATGAACCTGAGCTCAGAATCAAAGCTAAGCGAGTCTTGTACAGGGGCACGCTTTAGACGTTTTATCTCCTGTGTGTAGCCTTGTTTGTTGGGATCACTCATTCCATCTATATCCATAGGGTTAGTGACATAGCTCTGGAAGGTGGTGCTCATCTGTGAAATGTTTCCACTGCCATCAGGGATGCTCGCACTTGTGGACTGTGGAGTGGCTGATTCACTTTGTTCGTGGAGTAGCTGATGAATCGGGTTGAGTATCTGGCACCTATCACACCAAATGTTTCAATGCCAGCCAAGGAAGCGCGGGCTCGCCGCTGAGTGGGGGGCTTCTTCTCTGGAAAAGAGGAGGAAAAAGGAAACTTTCGCGGGGCCCGTGCAAACGACCCCAATAAGAAAGAGAAAAAAAATCTGTGTTGGGGAGGGGGCGGGCGACACACCCAATAACTAATATTCTTGGGGCGGTCCCCCATGGAGGGCTACCGCGCAGAGAAGATAAAACAAACCCCTGTTAGGATAAGAAGGGCGCGGCAACCCCAGGGGGGGGGCGCGGAGCGGTCGGCACAAAAAAGGAGGTTTTACTTTAATTTCCTCGGGGGGGGGGGCGCACCCCCAAAAAGCGGGGAGGAGAACTAAGGAAATTTGTGGGGGGGGGGGGGACGCCCCCAGGGCGGACGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGACCTTGCAAAGAGAGTA