ORFeome > pten ORF1 – XORFeome v1.0

pten ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pten
Gene ID: 491437
Gene Page ID: 491432
ORF Xenbase ID: 17291559

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129555
Original XGC clone length: 1209

Human orthology & disease relationships

NCBI Entrez ID: 5728
Ensembl gene IDs: ENSG00000171862,LRG_311
Directly associated (OMIM) disease MIM numbers: 153480,155600,158350,176807,188470,275355,276950,605309,607174,608089,613028
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,114480,114500,121850,125853,137800,153480,158350,176807,176920,191100,261550,276950,300291,300301,300555,300584,308300,309000,604370,607785,608089

Library Location

Plate ID: GDExl11086
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ837847
dbEST ID: 79655549
Trimmed Sequence: ATGACCGCCATCATCAAGGAGTTCGTTAGTAGGAACAAGAGGCGCTACCAGGAGGATGGATTCGACTTGGACCTCACCTATATTTATCCAAACATCATTGCCATGGGCTTTCCTGCAGAGAGGCTGGAAGGTGTATACAGAAATAACATCGATGATGTAGTGAGGTTTCTGGACTCGAAGCATAAAAATCATTACAAGATCTACAATTTGTGTGCAGAGAGACATTATGATACCAACAAATTTAGCTGCAGAGTTGCCCAGTATCCGTTTGAAGACCACAACCCACCACAGCTAGAGCTCATCAAACCTTTCTGTGAAGATCTTGACCAGTGGTTAAGTGAGAATGAGAACGTAGCAGCTATACATTGTAAAGCCGGCAAGGGTCGGACGGGGGTTATGATTTGTGCCTATTTGCTACACAGACGCAAATTTCCTAAAGCACAAGAAGCCCTAGATTTTTATGGAGAAATACGGACCAGAGATAAAAAGGGAGTCACAATTCCCAGCCAAAGGCGCTATGTATATTACTATAGCTACTTGTTAAAAAATAACCTGGAATACAGACCGGTGCCCCTGCTATTTCACAAGATGGATTTTGAAACGATTCCCATGGTTCATAGCTCACCATTGCATCCCCCGTTTCTCCGTTTACCCACTGAAAGTCAGAAACCTTCACTTCAACACCGGGTCCCCAACGAACAAAAAAAGTTTTTGTTATTTTTGATTTTCCCCAACCCCTTTGCTGGGTTTGTCGGGGACAATCAGGGGTAAAGTTTTTTCTCCCCAAACCAAAACCAAAAATTGAATGGAAAAAA
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCGCCATCATCAAGGAGTTCGTTAGTAGGAACAAGAGGCGCTACCAGGAGGATGGATTCGACTTGGACCTCACCTATATTTATCCAAACATCATTGCCATGGGCTTTCCTGCAGAGAGGCTGGAAGGTGTATACAGAAATAACATCGATGATGTAGTGAGGTTTCTGGACTCGAAGCATAAAAATCATTACAAGATCTACAATTTGTGTGCAGAGAGACATTATGATACCAACAAATTTAGCTGCAGAGTTGCCCAGTATCCGTTTGAAGACCACAACCCACCACAGCTAGAGCTCATCAAACCTTTCTGTGAAGATCTTGACCAGTGGTTAAGTGAGAATGAGAACGTAGCAGCTATACATTGTAAAGCCGGCAAGGGTCGGACGGGGGTTATGATTTGTGCCTATTTGCTACACAGACGCAAATTTCCTAAAGCACAAGAAGCCCTAGATTTTTATGGAGAAATACGGACCAGAGATAAAAAGGGAGTCACAATTCCCAGCCAAAGGCGCTATGTATATTACTATAGCTACTTGTTAAAAAATAACCTGGAATACAGACCGGTGCCCCTGCTATTTCACAAGATGGATTTTGAAACGATTCCCATGGTTCATAGCTCACCATTGCATCCCCCGTTTCTCCGTTTACCCACTGAAAGTCAGAAACCTTCACTTCAACACCGGGTCCCCAACGAACAAAAAAAGTTTTTGTTATTTTTGATTTTCCCCAACCCCTTTGCTGGGTTTGTCGGGGACAATCAGGGGTAAAGTTTTTTCTCCCCAAACCAAAACCAAAAATTGAATGGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCGCCATCATCAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837846
dbEST ID: 79655548
Trimmed Sequence: GACTTTTGTAATTTGTGTGATCTGATCTTCATCAAAAGGTTCATTCTCTGGATCAGAGTCAGTGGTGTCGGAATATCGATAATGATCAGGTTCATTGTCACTAACATCCGGCGTTACAGAAGTTGAGCTGCTCGCTTCGGAGTTTGAAGATTCTTCTACAGTCTTGGTGAAAAATAACTTCACTATGAAGTTTGGAGAGAATAATCTGTTGGCTTTGTCTTTGTTAGCTTTATCTAGGTCGTTTTTAGTTAAAGTGAGGGTGAGATATTCCTTGTCATTATCTGAACGCTCTGTACTGTAGATGCCATCAAGCTCATGCTCCCCAACCAACGTTCCGTTTTCTACTTTTTCCGAATACTCTTCCGGTCCTGGTATGAAGAATGTGTTTACCCAAAAATGGAACATCTTTTCCTTTTTCATCACTTTGTTCTGTTTGTGGAAAAACTCTACCTTGATGTCCCCGCAAACAGGCAAAGGCTGGGGGAAGTCAAAATACATATACTTTTCTGCTCGCTTGGGAGCTGCTGTTGAAGTGAAAATCTTGACTTTCAGCTGGTAGACGATGAACTAGAGATTGCATGTGGAGCTACTGAACATTGAAATCGGTTCAAACTTCATCTTGTTAAATAGCAGAGGCACCGGTCTGTGTTCGAGGTTATTTGTGAATTATTAACTATAGTAATATACGATACGCCTTGGGCTGGGAGATGTGAGTCCCGTTCTCATCTTGGGTCCTGGTTGCTCCAGAAAATCTAAAGGCTTCTTGTGGTTGAGGAAATTTACATCTGTTGTAGGGAAGGGCACGAAATAAAACCCACAACCAAACCCTTGCCGCCTGGCGGGGGGAGAGTGCGAGGGTTACATTCACGCTTAACAGCNTGACAAGATGCTCGAGAAAGAGTTTAAGAACGCTGGCGTGGGGGGCTTTGGGGGGGGGGGGGGGGGAAAACCAAACCCAGCCCACGGGGTTTTTTGTTGTGAGATGGTGTGTGGGGGGGGAAGAGGGGAAGAACAGAGAAAGAATTTTAAGGGTTTGAGTTCGTGAGGCGCTCCCGCCGCGCGCCCAAGAAAGAAAAAGAGAAAAAACGGCGGGAACCCTCCCCGACCGGGCGGGGCGCCCCCCGAACGCCCGCGGCCCAAAACGCGGGGGGGGGGAAGAGGAGAGGTGGGGAGAAAGGAGAGAAAAGA
Full Trace Sequence: GGGCGGGTAACATGCTTATGAACATTGTAATACGACTCACTACTAGGGGAAACCAGCCAGGAGGGCAAAAAAGATATTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTTTTGTAATTTGTGTGATCTGATCTTCATCAAAAGGTTCATTCTCTGGATCAGAGTCAGTGGTGTCGGAATATCGATAATGATCAGGTTCATTGTCACTAACATCCGGCGTTACAGAAGTTGAGCTGCTCGCTTCGGAGTTTGAAGATTCTTCTACAGTCTTGGTGAAAAATAACTTCACTATGAAGTTTGGAGAGAATAATCTGTTGGCTTTGTCTTTGTTAGCTTTATCTAGGTCGTTTTTAGTTAAAGTGAGGGTGAGATATTCCTTGTCATTATCTGAACGCTCTGTACTGTAGATGCCATCAAGCTCATGCTCCCCAACCAACGTTCCGTTTTCTACTTTTTCCGAATACTCTTCCGGTCCTGGTATGAAGAATGTGTTTACCCAAAAATGGAACATCTTTTCCTTTTTCATCACTTTGTTCTGTTTGTGGAAAAACTCTACCTTGATGTCCCCGCAAACAGGCAAAGGCTGGGGGAAGTCAAAATACATATACTTTTCTGCTCGCTTGGGAGCTGCTGTTGAAGTGAAAATCTTGACTTTCAGCTGGTAGACGATGAACTAGAGATTGCATGTGGAGCTACTGAACATTGAAATCGGTTCAAACTTCATCTTGTTAAATAGCAGAGGCACCGGTCTGTGTTCGAGGTTATTTGTGAATTATTAACTATAGTAATATACGATACGCCTTGGGCTGGGAGATGTGAGTCCCGTTCTCATCTTGGGTCCTGGTTGCTCCAGAAAATCTAAAGGCTTCTTGTGGTTGAGGAAATTTACATCTGTTGTAGGGAAGGGCACGAAATAAAACCCACAACCAAACCCTTGCCGCCTGGCGGGGGGAGAGTGCGAGGGTTACATTCACGCTTAACAGCNTGACAAGATGCTCGAGAAAGAGTTTAAGAACGCTGGCGTGGGGGGCTTTGGGGGGGGGGGGGGGGGAAAACCAAACCCAGCCCACGGGGTTTTTTGTTGTGAGATGGTGTGTGGGGGGGGAAGAGGGGAAGAACAGAGAAAGAATTTTAAGGGTTTGAGTTCGTGAGGCGCTCCCGCCGCGCGCCCAAGAAAGAAAAAGAGAAAAAACGGCGGGAACCCTCCCCGACCGGGCGGGGCGCCCCCCGAACGCCCGCGGCCCAAAACGCGGGGGGGGGGAAGAGGAGAGGTGGGGAGAAAGGAGAGAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTTTGTAATTTGTGTGATCTG