ORFeome > pter ORF1 – XORFeome v1.0

pter ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pter
Gene ID: 1007038
Gene Page ID: 1007034
ORF Xenbase ID: 17291565

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056120
Original XGC clone length: 1050

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ824709
dbEST ID: 79642411
Trimmed Sequence: 0
Full Trace Sequence: AATGACTTCATTTAGCGACCGAAGAGTGACATGTTCATATGCGACTCATAGAAGATGGACGCATTTTGATACCGGGCACCTCGGGCCAGAGATTCGGAATCTCGTAGGCTACAGAGTGGCAAAGTACAAACTGTGTTGGGGCCCATCCATTCAGATCAGCTGGGCCACACCTTGACACATGAACATTTATCGATGACTTTTGAATGCTGCTACTGCCCACCTCCAGCACCTCAGGGAGCATTGTCAGATGCCCCCATACTTATGAAGAATTTGTTTTGGGTGAAGCAAAACCCTTACAGCAATAAGGAGAACCTTCTTCTCAATCAGGAAATTGATGCAATAAGTGAAGAACTGAAGCTTTTTAAGGCAGCAGGGGGTGGAAGTATTGTAGAAAACACAACTACTGGCATTAGCAGAGATGTAAAGATGTTGAAGAAGCTTGCAGAAGAGACCGGAGTGAATATTATCTCAGGAGCTGGATTTTATGTGGATGCTACTCACTCTAATTCAACCCGCTCCATGACAGTGGAACAGCTTACAGAAGTCCTAGTTAATGAAGTACTTCAAGGAGCAGATGGAACAAATATTAAATGCGGCATCATTNGGGGAGATTGGCTGCTCCTGGCCATTAACAGAAAGTGAGAAGAAAGTTCTTCAAGCAACTGCCGAGGCACAGTCTCAGCTTGGCTGTCCTGTGAATATCCACCCTGGGAGAAATAGTGATGCACCCTTCCAGATTATCCAGATCCTGCAGGAGGCCGGGGGCGGAATCTCCAAAACAGTAATGTCTCATCTTTGATAGAACAATATTTGATGAGACAAACCTGCCTGAGGTTTCTAAACTTTGATCCCACCCTGGGGGATCCAATTTATTCCGAAACAAAATGGCTTAAATTACCCATTTTAACCAACCCATCCAAAATTGCCCAAGTGAAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTCGCTTAGTGGCAAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830061
dbEST ID: 79647763
Trimmed Sequence: TTTAAATGTTAGCCACTTTTTGGGATTCTCCAGTAATATCTTATCAATGCATTGCTGGGATATTCCTCTAATAAGCATTTTGGGAACAATGTTATTGAGGATGTGAGAGTATCCATGGCCACCATATTTGAGCAGCCTATTCTTTGTATGTATGTCATGGGAGACAACAATTCTGTCTTCATAGCCTTCATTAATCAGGAACCGAAGCATTTTAATTCTGTCATTGTCACTTGGCATATCGACTGCTTGGTTAAACTGGTAATTCAGCATTTCTGTTCCGAATAAATCGTACTCCAGGTAGGATCCAAGTTTAGCAAACTCCAGCAGTTTTGTCTCATCAAATATTGTCCTATCAAGATGAGACATTACTGTTTTGGAGATATCCGCCCCGGCCTCCTGCAGGATCTGGATAATCTGGAAGGGTGCATCACTATTTCTCCCAGGGTGGATATTCACAGGACAGCCAAGCTGAGACTGTGCCTCGGCAGTTGCTTGAAGAACTTTCTTCTCACTTTCTGTTAATGGCCAGGAGCAGCCAATCTCCCCAATGATGCCGCATTTAATATTTGTTCCATCTGCTCCTTGNAGTACTTCATTAACTAGGACTTTCTGTAGCTGTTCCACTGTCATGGAAGCGGGTTGAAATTAGAGTGAGTAGCATCCACATAAAAATCCAGCTCCTGAGATAATAATTCACTTCCGGTCTCTTTCTGCAAACTTCCTTCACCTTCCTTTACATCCTTCTCCCAAATGGCCCACTTTAATTTG
Full Trace Sequence: TGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGGGCGCTAGCTTACTACTGGTCGTCGTTTTACGACGTCCTGACTGGGATTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTAAATGTTAGCCACTTTTTGGGATTCTCCAGTAATATCTTATCAATGCATTGCTGGGATATTCCTCTAATAAGCATTTTGGGAACAATGTTATTGAGGATGTGAGAGTATCCATGGCCACCATATTTGAGCAGCCTATTCTTTGTATGTATGTCATGGGAGACAACAATTCTGTCTTCATAGCCTTCATTAATCAGGAACCGAAGCATTTTAATTCTGTCATTGTCACTTGGCATATCGACTGCTTGGTTAAACTGGTAATTCAGCATTTCTGTTCCGAATAAATCGTACTCCAGGTAGGATCCAAGTTTAGCAAACTCCAGCAGTTTTGTCTCATCAAATATTGTCCTATCAAGATGAGACATTACTGTTTTGGAGATATCCGCCCCGGCCTCCTGCAGGATCTGGATAATCTGGAAGGGTGCATCACTATTTCTCCCAGGGTGGATATTCACAGGACAGCCAAGCTGAGACTGTGCCTCGGCAGTTGCTTGAAGAACTTTCTTCTCACTTTCTGTTAATGGCCAGGAGCAGCCAATCTCCCCAATGATGCCGCATTTAATATTTGTTCCATCTGCTCCTTGNAGTACTTCATTAACTAGGACTTTCTGTAGCTGTTCCACTGTCATGGAAGCGGGTTGAAATTAGAGTGAGTAGCATCCACATAAAAATCCAGCTCCTGAGATAATAATTCACTTCCGGTCTCTTTCTGCAAACTTCCTTCACCTTCCTTTACATCCTTCTCCCAAATGGCCCACTTTAATTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTAAATGTTAGCCACTTTTTGGG