ORFeome > ptges3 ORF1 – XORFeome v1.0

ptges3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ptges3
Gene ID: 943104
Gene Page ID: 943095
ORF Xenbase ID: 17291595

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044075
Original XGC clone length: 483

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ823551
dbEST ID: 79641253
Trimmed Sequence: ATGCAGCCAGCATCTGCAAAGTGGTACGACAGAAGAGACTATGTCTTTCTTGAATTTTGTGTGGAGGACAGCAAAAATGTAAAAACAGACTTCGATAAAAATAAATTAACATTCAGTTGTCTTGGAGGAGCGGATAGTGTAAAATATTTAAATGAAGTTGAACTTTTTCAGTCTATTGATCCCAATGCATCTAAACATAAAAGAACAGACAGATCTGTTTTGTGTTGTTTACGAAAAGGAGAGCCTGGAAAATCATGGCCACGACTGACAAAAGAAAAGGCAAAGCTTAATTGGCTTAGTGTGGACTTCAATAACTGGAAAGATTGGGAAGATGACTCTGATGAAGACATGTCAAATTTTGACCACTTTTCTGAGATGATGAACAATATGGGAGGAGATGAGGATGTAGATTTACCAGAAGTAGATGGTGCAGATGATGACTCACCAGACAGTGATGATGAAAAAATGCCTGACCTTGAATT
Full Trace Sequence: CCAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCCAGCATCTGCAAAGTGGTACGACAGAAGAGACTATGTCTTTCTTGAATTTTGTGTGGAGGACAGCAAAAATGTAAAAACAGACTTCGATAAAAATAAATTAACATTCAGTTGTCTTGGAGGAGCGGATAGTGTAAAATATTTAAATGAAGTTGAACTTTTTCAGTCTATTGATCCCAATGCATCTAAACATAAAAGAACAGACAGATCTGTTTTGTGTTGTTTACGAAAAGGAGAGCCTGGAAAATCATGGCCACGACTGACAAAAGAAAAGGCAAAGCTTAATTGGCTTAGTGTGGACTTCAATAACTGGAAAGATTGGGAAGATGACTCTGATGAAGACATGTCAAATTTTGACCACTTTTCTGAGATGATGAACAATATGGGAGGAGATGAGGATGTAGATTTACCAGAAGTAGATGGTGCAGATGATGACTCACCAGACAGTGATGATGAAAAAATGCCTGACCTTGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCCAAACCTTTAAAAAGATTTAAAACCNGGNNNNGGCTNNGGGGAGAGTTTTGTCTGAACCCCAGACCTTGCCCTTGGCCCGGGGGTATCTCCCTTCCGTCTCCCCGGGCGGTGTTCTTTAAAATTCTATTCCGCAAAAATCAAAAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCCAGCATCTGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828849
dbEST ID: 79646551
Trimmed Sequence: TTCAAGGTCAGGCATTTTTTCATCATCACTGTCTGGTGAGTCATCATCTGCACCATCTACTTCTGGTAAATCTACATCCTCATCTCCTCCCATATTGTTCATCATCTCAGAAAAGTGGTCAAAATTTGACATGTCTTCATCAGAGTCATCTTCCCAATCTTTCCAGTTATTGAAGTCCACACTAAGCCAATTAAACTTTGCCTTTTCTTTTGTCAGTCGTGGCCATGATTTTCCAGGCTCTCCTTTTCGTAAACAACACAAAACAGATCTGTCTGTTCTTTTATGTTTAGATGCATTGGGATCAATAGACTGAAAAAGTTCAACTTCATTTAAATATTTTACACTATCCGCTCCTCCTAGACAACTGAAGGTTAATTTATTTTTATCGAAGTCTGTGTTTACATTTTTGCTGTCCTCCACACATGATTCAAGAAAGACATATTCTCTTCTGTCGTACCACTTTGCAGATGCTGGCTGCATGG
Full Trace Sequence: GGACGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAAGGTCAGGCATTTTTTCATCATCACTGTCTGGTGAGTCATCATCTGCACCATCTACTTCTGGTAAATCTACATCCTCATCTCCTCCCATATTGTTCATCATCTCAGAAAAGTGGTCAAAATTTGACATGTCTTCATCAGAGTCATCTTCCCAATCTTTCCAGTTATTGAAGTCCACACTAAGCCAATTAAACTTTGCCTTTTCTTTTGTCAGTCGTGGCCATGATTTTCCAGGCTCTCCTTTTCGTAAACAACACAAAACAGATCTGTCTGTTCTTTTATGTTTAGATGCATTGGGATCAATAGACTGAAAAAGTTCAACTTCATTTAAATATTTTACACTATCCGCTCCTCCTAGACAACTGAAGGTTAATTTATTTTTATCGAAGTCTGTGTTTACATTTTTGCTGTCCTCCACACATGATTCAAGAAAGACATATTCTCTTCTGTCGTACCACTTTGCAGATGCTGGCTGCATGGTGCCGACTGTTTTGTACCAAGTTGGTATTATAAACAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCCATCCAAATAAAATCATTATTTGGGGGCAAACACTAAGAAGGGCGTCATATACACGACCGTGACCGGAGAGGAAAGGGGTTCACCTTTGTTCACCCACTTTACAAGGAACAAACAGAAATGGTTATACGTCCCCCCTGGCAGTTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAAGGTCAGGCATTTTTTCATC