ORFeome > ptma ORF1 – XORFeome v1.0

ptma ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ptma
Gene ID: 6256517
Gene Page ID: 978346
ORF Xenbase ID: 17291625

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054174
Original XGC clone length: 336

Human orthology & disease relationships

NCBI Entrez ID: 5757
Ensembl gene IDs: ENSG00000187514
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114500,132600,155255,603278

Library Location

Plate ID: GDExl11001
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ839186
dbEST ID: 79656888
Trimmed Sequence: ATGTCAGACACAGCAGTGGACGCCAGTGTTGAGAAGACCACCAAGGACTTAAAAGCAAAAGAGAAGGAAGTTGTAGAAGAAGCAGAAAATGGAAAGGACAAGCCTACCAATGGAAAAGCAGAAAATGAGGAAAATGGAGAGCCAGAGGTAGATAATGAAGGCGACGAAGAAGATGAGGTAGATGAGGAAGATGAAGAGGATGAAGTAGAAGGAGAAGATGACGATGACGATGATGAAGTAGAGGGAGTCACCGGCAAGAGAGCAGCAGAAGATGATGAGGATGATGATGATGATGATGTTGAAATAAAGAAGCAGAAAACAGATGAAGATGACTT
Full Trace Sequence: GGGGATCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGACACAGCAGTGGACGCCAGTGTTGAGAAGACCACCAAGGACTTAAAAGCAAAAGAGAAGGAAGTTGTAGAAGAAGCAGAAAATGGAAAGGACAAGCCTACCAATGGAAAAGCAGAAAATGAGGAAAATGGAGAGCCAGAGGTAGATAATGAAGGCGACGAAGAAGATGAGGTAGATGAGGAAGATGAAGAGGATGAAGTAGAAGGAGAAGATGACGATGACGATGATGAAGTAGAGGGAGTCACCGGCAAGAGAGCAGCAGAAGATGATGAGGATGATGATGATGATGATGTTGAAATAAAGAAGCAGAAAACAGATGAAGATGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGGTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGACAAAGAAAAAAAACACAGATGTTACAAATANCCGTAGAGGAGCCTGGGAGGAGAAAAAAAAAAAAAAAGACCGCAGAGTGAGGGGTGTCTCTCGTCAGGATATGGGGTGGGAGGGACGCCCTGCAACCACAACATTCCCCTCGGAGTGGCGCGGGAGGAACACGCCACAGGCCCACCAGGGGGGAGGCGACAATTACACCGGGAAGGAAGACGCTGGNGGCGGTGTGGAGGTGTGGGTATGAAGAGGAATTTGGTTGGGGTGCCCCTCCGCCTCCCCGGGCCGCCCCAAAACACCCAGATGAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGACACAGCAGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839185
dbEST ID: 79656887
Trimmed Sequence: GTCATCTTCATCTGTTTTCTGCTTCTTTATTTCAACATCATCATCATCATCATCCTCATCATCTTCTGCTGCTCTCTTGCCGGTGACTCCCTCTACTTCATCATCGTCATCGTCATCTTCTCCTTCTACTTCATCCTCTTCATCTTCCTCATCTACCTCATCTTCTTCGTCGCCTTCATTATCTACCTCTGGCTCTCCATTTTCCTCATTTTCTGCTTTTCCATTGGTAGGCTTGTCCTTTCCATTTTCTGCTTCTTCTACAACTTCCTTCTCTTTTGCTTTTAAGTCCTTGGTGGTCTTCTCAACACTGGCGTCCACTGCTGTGTCTGACATGG
Full Trace Sequence: CGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCATCTTCATCTGTTTTCTGCTTCTTTATTTCAACATCATCATCATCATCATCCTCATCATCTTCTGCTGCTCTCTTGCCGGTGACTCCCTCTACTTCATCATCGTCATCGTCATCTTCTCCTTCTACTTCATCCTCTTCATCTTCCTCATCTACCTCATCTTCTTCGTCGCCTTCATTATCTACCTCTGGCTCTCCATTTTCCTCATTTTCTGCTTTTCCATTGGTAGGCTTGTCCTTTCCATTTTCTGCTTCTTCTACAACTTCCTTCTCTTTTGCTTTTAAGTCCTTGGTGGTCTTCTCAACACTGGCGTCCACTGCTGTGTCTGACATGGTGCGAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGATCACTATCAATCAAAATAAAATCATTATTTGGGGCCCAACCTTAAAACTGGAAAACGTTCATAACGTCATGACTGGGATGTTTCCTGGCAGCTCTGGGCCAAGTCTCAAAAACACTAATATAAAAAAANANNNNNTNNNNNNNNNNNNNNNGGCNNGNNCNNAAAANAANAAAAANTNNNNNNGNNAANNNNNNNNNNNNNNCNNNNNTNNNNNNNNNNGNNNNNAANANNNANNNNANNNNAANNNNNNNANNAANNNNNNNNNNNNNNNNTTNNTTNTNTTNNNNNNNNNNANAGNNNNNNNNNANNNNNNGNNAANNGNNANNNNNNNNNNNNNNNATNNNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATCTTCATCTGTTTTCTGCT