ORFeome > ptpla ORF1 – XORFeome v1.0

ptpla ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ptpla
Gene ID: 957003
Gene Page ID: 956999
ORF Xenbase ID: 17291679

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082913
Original XGC clone length: 723

Human orthology & disease relationships

NCBI Entrez ID: 9200
Ensembl gene IDs: ENSG00000165996
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 309549

Library Location

Plate ID: GDExl11003
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ839636
dbEST ID: 79657338
Trimmed Sequence: ATGGCATCAAGCGATGATGAAGGGTCCGTGGAAGAGAAGGAGCCTCCCAAGAAAAAGATCGGTCCCGTGGCCACGGCATGGCTCACCTTTTACAACATTGCCATGACAGCTGGGTGGCTTGTTCTTGCCATAGCCATGATCCGATTTTATGCGGAAAAAGGAACACACAAGGGTTTGTACAGAAATATACAGAAGACACTTAAATGTTTCCAGACATTTGCTTTACTTGAGCTGATCCACTGCGCACTGGGAATAGTGCACACATCGGTGCTAGTAACAGGGGTCCAAGTCAGTTCAAGAATCTTCATGGTCTGGTTTATTACAAGCAGTATAAAGAAGGTCCAGAGTGAAGAAGGCGTTCTTATTTTTCTTGTCGTATGGACTGTGACAGAGATCACGCGATATTCCTACTACACATTCAAACTTCTCAACCACTTGCCATACTTCATTAAATGGGCCAGGTATAATTTATTTATTGTTCTGTATCCTGTTGGTGTTGTTGGGGAACTCCTGACTATTTATGCTGCTTTGCCCCACGTGCGGAAGAGTGCGATGTATTCTCTTAGACTTCCCAACAAATACAACGTTTCTTTCGACTACTACTACTTCCTGATCATCGTAATGTGTTCTTATATACCATTATTTCCCCCGTTGTACCTCCACATGCTGCGCCAGAAGAAGAAAAGTTCTGTAACGGGGAAGTGGACAATGGAAGAAAGACAACTTTGCCACCTTTCTTGTAACAAGTTTGGCGTTAAAAAAAAAAGCCATGGCCTTATAAAATTTTGTTTCCCACCAAAAAGGGTTCACTTATTCAAGGTACAAAATAAAA
Full Trace Sequence: CAGGGGCCAAATAATAGATTTTATTTTNGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATCAAGCGATGATGAAGGGTCCGTGGAAGAGAAGGAGCCTCCCAAGAAAAAGATCGGTCCCGTGGCCACGGCATGGCTCACCTTTTACAACATTGCCATGACAGCTGGGTGGCTTGTTCTTGCCATAGCCATGATCCGATTTTATGCGGAAAAAGGAACACACAAGGGTTTGTACAGAAATATACAGAAGACACTTAAATGTTTCCAGACATTTGCTTTACTTGAGCTGATCCACTGCGCACTGGGAATAGTGCACACATCGGTGCTAGTAACAGGGGTCCAAGTCAGTTCAAGAATCTTCATGGTCTGGTTTATTACAAGCAGTATAAAGAAGGTCCAGAGTGAAGAAGGCGTTCTTATTTTTCTTGTCGTATGGACTGTGACAGAGATCACGCGATATTCCTACTACACATTCAAACTTCTCAACCACTTGCCATACTTCATTAAATGGGCCAGGTATAATTTATTTATTGTTCTGTATCCTGTTGGTGTTGTTGGGGAACTCCTGACTATTTATGCTGCTTTGCCCCACGTGCGGAAGAGTGCGATGTATTCTCTTAGACTTCCCAACAAATACAACGTTTCTTTCGACTACTACTACTTCCTGATCATCGTAATGTGTTCTTATATACCATTATTTCCCCCGTTGTACCTCCACATGCTGCGCCAGAAGAAGAAAAGTTCTGTAACGGGGAAGTGGACAATGGAAGAAAGACAACTTTGCCACCTTTCTTGTAACAAGTTTGGCGTTAAAAAAAAAAGCCATGGCCTTATAAAATTTTGTTTCCCACCAAAAAGGGTTCACTTATTCAAGGTACAAAATAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCAAGCGATGATGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839635
dbEST ID: 79657337
Trimmed Sequence: GTCGTCCTTCTCCATGATCACCTCCCCGTACAGAACTCTCCTTCTCTGGCGCAGCATGTGGAAGTACAACTGGGGAAATAATGGTATATAAGAACACATTACGATGATCAGGAAGTAGTAGTAGTCGAAAGAAACGTTGTATTTGTTGGGAAGTCTAAGAGAATACATCGCACTCTTCCGCACGTGGGGCAAAGCAGCATAAATAGTCAGGAGTTCCCCAACAACACCAACAGGATACAGAACAATAAATAAATTATACCTGGCCCATTTAATGAAGTATGGCAAGTGGTTGAGAAGTTTGAATGTGTAGTAGGAATATCGCGTGATCTCTGTCACAGTCCATACGACAAGAAAAATAAGAACGCCTTCTTCACTCTGGACCTTCTTTATACTGCTTGTAATAAACCAGACCATGAAGATTCTTGAACTGACTTGGACCCCTGTTACTAGCACCGATGTGTGCACTATTCCCAGTGCGCAGTGGATCAGCTCAGGTAAAGCAAATGTCTGGAAACATTTAAATGTCTTCCGTATATTTCTGTACAAACCCCTGTGTGTTCCTTTTTCCGCATAAAATCGGATCATGGCTATGGCAAGACCAAGCATCCAGCCGTCCTGGCAATGGTGTAAAAGGTGAACCATGGCGGGGCCCCGGGACCAATCTTTTTCCTGGGAGGCGCCTTCTCTTCCGCCCACCCTTCACCTTCTCCTTGAGCCCCGGGTGGCAACCTTTTTGGGGACAAAAATTGGGCCTTTTTAAAAA
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGTCCTTCTCCATGATCACCTCCCCGTACAGAACTCTCCTTCTCTGGCGCAGCATGTGGAAGTACAACTGGGGAAATAATGGTATATAAGAACACATTACGATGATCAGGAAGTAGTAGTAGTCGAAAGAAACGTTGTATTTGTTGGGAAGTCTAAGAGAATACATCGCACTCTTCCGCACGTGGGGCAAAGCAGCATAAATAGTCAGGAGTTCCCCAACAACACCAACAGGATACAGAACAATAAATAAATTATACCTGGCCCATTTAATGAAGTATGGCAAGTGGTTGAGAAGTTTGAATGTGTAGTAGGAATATCGCGTGATCTCTGTCACAGTCCATACGACAAGAAAAATAAGAACGCCTTCTTCACTCTGGACCTTCTTTATACTGCTTGTAATAAACCAGACCATGAAGATTCTTGAACTGACTTGGACCCCTGTTACTAGCACCGATGTGTGCACTATTCCCAGTGCGCAGTGGATCAGCTCAGGTAAAGCAAATGTCTGGAAACATTTAAATGTCTTCCGTATATTTCTGTACAAACCCCTGTGTGTTCCTTTTTCCGCATAAAATCGGATCATGGCTATGGCAAGACCAAGCATCCAGCCGTCCTGGCAATGGTGTAAAAGGTGAACCATGGCGGGGCCCCGGGACCAATCTTTTTCCTGGGAGGCGCCTTCTCTTCCGCCCACCCTTCACCTTCTCCTTGAGCCCCGGGTGGCAACCTTTTTGGGGACAAAAATTGGGCCTTTTTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGTCCTTCTCCATGAT