ORFeome > ptrhd1 ORF1 – XORFeome v1.0

ptrhd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ptrhd1
Gene ID: 6252470
Gene Page ID: 5904677
ORF Xenbase ID: 17291769

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123341
Original XGC clone length: 357

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ837350
dbEST ID: 79655052
Trimmed Sequence: ATGGCGGCTCTGGTTCAGTACGTGGTGCTCCGCAAGGATCTGCAGACTGGACTCGGGTGGCCCCTGGGGGGCCCTAATAGCACAAGCCTGTCACGCGGCCACAGCAGTGATTCATTTACACTACGAGCACCCGAATACCCGGGCCTACCTGCAGCAGCTCGACTCTATGCACAAAGTGGTTCTGGAGGTGGCGGATGAGCTGACACTCACTTCTCTGTCGGAGACGCTGAATCAGGCAGGGATTGATCACAAGCTGTGGATGGAGCAGCCAGAGAACATCGCTACTTGTATCGCCCTCAGGCCGTATGTGAAGGAGGAAGTTCATAAATATGTGAAGAAATTTAAGCTGATGAAGTT
Full Trace Sequence: TGCGAGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCTGGTTCAGTACGTGGTGCTCCGCAAGGATCTGCAGACTGGACTCGGGTGGCCCCTGGGGGGCCCTAATAGCACAAGCCTGTCACGCGGCCACAGCAGTGATTCATTTACACTACGAGCACCCGAATACCCGGGCCTACCTGCAGCAGCTCGACTCTATGCACAAAGTGGTTCTGGAGGTGGCGGATGAGCTGACACTCACTTCTCTGTCGGAGACGCTGAATCAGGCAGGGATTGATCACAAGCTGTGGATGGAGCAGCCAGAGAACATCGCTACTTGTATCGCCCTCAGGCCGTATGTGAAGGAGGAAGTTCATAAATATGTGAAGAAATTTAAGCTGATGAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAACTGGTTTCCTGGCAAAAAAAAAAAAAAATAAAAAATCCAAAAATATTACAACCCGCGTTCCCGCGCCGAAAAAAAAAAAACCCGCTAAAAAAAACCCCCAGGCTTTCGGTTTTTACACCTTCCGGGGAAGAAAAAAAAACCCAACAACAAAGAATACACCGCGTGCGTGTTTTTTATTTTTAAAGAAGTGATGCGGGAGGGCGCCCCCCCACCGGGGGCGAAACAAATTTGGAACACCCGGGGGGGGGGGGGGGGGCGGGTGGTGTTTTTTTTGTTTTTTTTTTAATATTTTTTTTTTATTATTATTTATATTTTCCGCCTCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCTGGTTCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837349
dbEST ID: 79655051
Trimmed Sequence: CTTCCTCCACCTTAAATTTCTTCACATATTTATGAACTTCCTCCTTCACATACGGCCTGAGGGCGATACAAGTAGCGATGTTCTCTGGCTGCTCCATCCACAGCTTGTGATCAATCCCTGCCTGATTCAGCGTCTCCGACAGAGAAGTGAGTGTCAGCTCATCCGCCACCTCCNGAACCACTTTGTGCATAGAGTCGAGCTGCTGCAGGTAGGCCCGGGTATTCGGGTGCTCGTAGTGTAAATGAATCACTGCTGTGGCCGCGTGACAGGCTTGTGCTATTAGGGCCCCCAAGGGCCACCCGAGTCCAGTCTGCAGATCCTTGCGGAGCACCACGTACTGAACCAGAGCCGCCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCCTCCACCTTAAATTTCTTCACATATTTATGAACTTCCTCCTTCACATACGGCCTGAGGGCGATACAAGTAGCGATGTTCTCTGGCTGCTCCATCCACAGCTTGTGATCAATCCCTGCCTGATTCAGCGTCTCCGACAGAGAAGTGAGTGTCAGCTCATCCGCCACCTCCNGAACCACTTTGTGCATAGAGTCGAGCTGCTGCAGGTAGGCCCGGGTATTCGGGTGCTCGTAGTGTAAATGAATCACTGCTGTGGCCGCGTGACAGGCTTGTGCTATTAGGGCCCCCAAGGGCCACCCGAGTCCAGTCTGCAGATCCTTGCGGAGCACCACGTACTGAACCAGAGCCGCCATGGTGCCAACTTTTTTGTACAAAATTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCTNTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAATACAAAAAAGACGGGGCAGAGTGGCCGGCCGCGAAAAAAAAACAAAACCCCCTCTCAAAAACCGGCGCTTTCCTGTGGCATATAATTAGGAAAAAGAAAAAAAACAAAAAACCCAAAGAACAAAAGCCGGGTGCGGTTTTGAAGATGAATAAGGGCNNTCCCTTATGGCCCCNGGCAGAGGGGCGAAAAACATTAAACAAAACCGNGGGGGGGGGGGGGCGGAGNNGGGNNNNTTTGGGGNNGTTGGNGANGGNNNNNNGGNNGGGGGGNNNNNNGNNGNGNGNGGGGNNNNGNGAAANGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCATCAGCTTAAATTTCTTCAC