ORFeome > pvalb.2 ORF1 – XORFeome v1.0

pvalb.2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pvalb.2
Gene ID: 5838365
Gene Page ID: 5837859
ORF Xenbase ID: 17291829

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078498
Original XGC clone length: 330

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ839824
dbEST ID: 79657526
Trimmed Sequence: ATGGCATTCGGTGGTCTCCTGAGTGAAGCTGACATCGCCTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCGGCAAGTCTGCAGCTGATGTGAAAAACGTCTTTGCCATCCTTGATCAGGACCAGAGCGGCTTCATTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAGCGCCGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCCTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAACTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATTCGGTGGTCTCCTGAGTGAAGCTGACATCGCCTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCGGCAAGTCTGCAGCTGATGTGAAAAACGTCTTTGCCATCCTTGATCAGGACCAGAGCGGCTTCATTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAGCGCCGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCCTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCATATTACATGGTCATAGCTGTTTCCTGGCAAAAAATGCCCGAAGAAAAGAATACTGCACATGACACACCTTCAAGACCCAGAAAAAAAGGCGCCCATTCAAAAAATCCACGTTTCCCGTGTAACTTTTTGGCGGAACGGAACAAGGAAAAACCCAAGGAATAAGCCGGTTTGTTCTATATTGTAAAGAAAGTGGGGGTGGGGGCCCCCCGGTGGGCAAAACCTTACGAGAAACACCGGGGAAAGGGGGGGGGGGGGTTTTGGTGGTTGTTTGAATATTTTTTTTGAGGAGAAAAAAAAACACCCGGCCCCCCACCCCCCAACCGCTGTGCGGCGCGAAGAAATTTTTGTGTGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATTCGGTGGTCTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839823
dbEST ID: 79657525
Trimmed Sequence: GTTTTTCACCAAAGCCTGGAATTCTTCAACTCCAATTTTGCCATCACCATCAGAGTCTCCAGCTGACAGGAAGGCCTTGGTCTCAGCATCAGTTAAAGCTCTGGCACCGGCGCTGAAGTTCTGGAGGAACAGCTTCAGTTCATCTTCCTCAATGAAGCCGCTCTGGTCCTGATCAAGGATGGCAAAGACGTTTTTCACATCAGCTGCAGACTTGCCGCTCAGACCAGACTGGGCAAAGAAAGTTTTGAAGTTGAAGGAGTCAGCAGCTTGGCAGTTCTGCAGAGCAGAGGCGATGTCAGCTTCACTCAGGAGACCACCGAATGCCATGG
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTTTCACCAAAGCCTGGAATTCTTCAACTCCAATTTTGCCATCACCATCAGAGTCTCCAGCTGACAGGAAGGCCTTGGTCTCAGCATCAGTTAAAGCTCTGGCACCGGCGCTGAAGTTCTGGAGGAACAGCTTCAGTTCATCTTCCTCAATGAAGCCGCTCTGGTCCTGATCAAGGATGGCAAAGACGTTTTTCACATCAGCTGCAGACTTGCCGCTCAGACCAGACTGGGCAAAGAAAGTTTTGAAGTTGAAGGAGTCAGCAGCTTGGCAGTTCTGCAGAGCAGAGGCGATGTCAGCTTCACTCAGGAGACCACCGAATGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCAACTTTAAGAAAGTACGTCGTTTTAAATAAAGTGACAGGGGAGTTCATGGCAGCTCTAACAGGTGGCCACAATCAAAAAAATAACAATCCTTGTAAACAGCGTAAGAAAAAAAGATACGCGAAAACACAAAAAAAACGGCGGGCATTTCCTGTCGGAAGGAAGGTCCTGTGGGCTTTCACAATGGGTGTGAGAAAAAACACAACCTCCGGGTAAAAGGCAAAAGCAACTCCTGCGGTTGTTTATATATTTTTTTGGAGGAAACGACTCCCCCGGGGCCCCCCAACAGCGCCGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTTCACCAAAGCCTGGAAT