ORFeome > pygo2 ORF1 – XORFeome v1.0

pygo2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pygo2
Gene ID: 6255185
Gene Page ID: 6454465
ORF Xenbase ID: 17291889

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057727
Original XGC clone length: 1170

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ824524
dbEST ID: 79642226
Trimmed Sequence: ATGGCTGCAGATCAGGACAAGTTGGATGGACTGACCGTTCCGGGCCGCAGAGCCAAGACTGGTATGCAAATGAAGAGCCCCGAGAAGAAACGGCGCAAGTCAAACACTCAGGGCCCCGCATACTCCCATCTTTCTGAATTTGCACCACCACCCACCCCAATGGTCGACCACCTGGTGGCGTCCAACCCTTTTGAAGATGACTTTGGAGCTCCGAAAGTCAATGCTGGCCCCTCCCCCTTCATGAGCAACCCGGTGCCCTTTGGAAACTACCGCATGCCGGGTGCCATGCCCCATCAGATGACCCCCGGCTATCCTGGTGGCCCACAGCCCATGAGAAGGCAGGCACCCCCTTTTCCTCCTAATCAGATGGGCCCTGGATTTGGAATGTCCCAAAACCCAAACTACCACCAGCCTGGAAACATGAACTTCCCCAATGCCCCCTTTAATCAAGCCATGGGTCAGGGCTTCAGCCCCCCTGCTGGGCAAATGATGCAAGGACCAGTAGTGAGGGTTTGGCCCAATGATGTCACCAAACATGGGTCAGCCCCCTAGAGGAGAGATGGGCCCTGGTCCTGTATTGAATTCTCCTGGTGGCCCTCCATTTACTCAAAGGTTTGGCCCATCAGGGCACCCATTTGGACAGCCCCCAGTGCCACGAGCCAGCCTACCACAAACAACAGTCCGTTTGCAGGGGCCGACAAAGCTCCCCCCCAAGGGGTTGAAGACACGGCAAGAACACCACCCTCCCAGCACACGGTTATCAAAACCAACCAGTTTGGGTGCCCTTCTGCTGTCATGGGAACCAAACCAAATTCATCTCCAAAAACTTCCACCGTGGGAAAGA
Full Trace Sequence: AAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCAGATCAGGACAAGTTGGATGGACTGACCGTTCCGGGCCGCAGAGCCAAGACTGGTATGCAAATGAAGAGCCCCGAGAAGAAACGGCGCAAGTCAAACACTCAGGGCCCCGCATACTCCCATCTTTCTGAATTTGCACCACCACCCACCCCAATGGTCGACCACCTGGTGGCGTCCAACCCTTTTGAAGATGACTTTGGAGCTCCGAAAGTCAATGCTGGCCCCTCCCCCTTCATGAGCAACCCGGTGCCCTTTGGAAACTACCGCATGCCGGGTGCCATGCCCCATCAGATGACCCCCGGCTATCCTGGTGGCCCACAGCCCATGAGAAGGCAGGCACCCCCTTTTCCTCCTAATCAGATGGGCCCTGGATTTGGAATGTCCCAAAACCCAAACTACCACCAGCCTGGAAACATGAACTTCCCCAATGCCCCCTTTAATCAAGCCATGGGTCAGGGCTTCAGCCCCCCTGCTGGGCAAATGATGCAAGGACCAGTAGTGAGGGTTTGGCCCAATGATGTCACCAAACATGGGTCAGCCCCCTAGAGGAGAGATGGGCCCTGGTCCTGTATTGAATTCTCCTGGTGGCCCTCCATTTACTCAAAGGTTTGGCCCATCAGGGCACCCATTTGGACAGCCCCCAGTGCCACGAGCCAGCCTACCACAAACAACAGTCCGTTTGCAGGGGCCGACAAAGCTCCCCCCCAAGGGGTTGAAGACACGGCAAGAACACCACCCTCCCAGCACACGGTTATCAAAACCAACCAGTTTGGGTGCCCTTCTGCTGTCATGGGAACCAAACCAAATTCATCTCCAAAAACTTCCACCGTGGGAAAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCAGATCAGGACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829875
dbEST ID: 79647577
Trimmed Sequence: ACCATCGTTGGCTGCCACCAGCTGGCCCATGGCCCCCCGGATGTAGACGGACTGGATTTCCTTGGTTTTCAGGCAGTAGTCACAAGCCCACACGGCCGAGACCTCTCTGGTGAGCAAGCTGTAGGCACTCTCAGTCATCCCTGTGCACTCTCTGTGGAACCATTTCTGGCACGATGCCTCACACAAGATGGCGTCTTGGTCATCATTGACTTCCCGCTCGCAGGCCCCACAGGGGTAAATAAGTCCGGGGGGCGGCTGGTGCCCAGAGTTGCCGGTGGGTTTGCTCGGGGGAGGGATGTTGTTGACTTCGGGGGTGCTGCTGTTGCCACGCGTGGAGTTGTTGGGAGTGAAGTTTGGTTGGTTCCCATTGACAGCAGAAGGCGACCCAACATGCTGGTCTTGATTAAACGTGTTGCTGGGAGGGTTGGTGTTCTTGCCGTGTTCTTCAACCCCTGGGGGGAAGCTTTGGTCGGCCCCTGCAAACGGACTGTTGTTTGGTGGTAGGCTGGCTCGTGGCACTGGGGGCTGTCCAAATGGGTGCCCTGATGGGCCAAACCTTTGAGTAAATGGAGGGGCACCAGGAGAATTCATTACCGGACCCGGGGCCATCTCTCCCTCTAGGGGGCTGAACCCATGTTTGGTGAAATCCTTGGGGCCAAACCCCTCCTACCGAGTCCTTGCATCATTTGCCCAAGCAAGGGGGGCTGAAACCCCTTGACCCCTGGCCTTGAATAAAAAGGGGGCGCAGT
Full Trace Sequence: GGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCATCGTTGGCTGCCACCAGCTGGCCCATGGCCCCCCGGATGTAGACGGACTGGATTTCCTTGGTTTTCAGGCAGTAGTCACAAGCCCACACGGCCGAGACCTCTCTGGTGAGCAAGCTGTAGGCACTCTCAGTCATCCCTGTGCACTCTCTGTGGAACCATTTCTGGCACGATGCCTCACACAAGATGGCGTCTTGGTCATCATTGACTTCCCGCTCGCAGGCCCCACAGGGGTAAATAAGTCCGGGGGGCGGCTGGTGCCCAGAGTTGCCGGTGGGTTTGCTCGGGGGAGGGATGTTGTTGACTTCGGGGGTGCTGCTGTTGCCACGCGTGGAGTTGTTGGGAGTGAAGTTTGGTTGGTTCCCATTGACAGCAGAAGGCGACCCAACATGCTGGTCTTGATTAAACGTGTTGCTGGGAGGGTTGGTGTTCTTGCCGTGTTCTTCAACCCCTGGGGGGAAGCTTTGGTCGGCCCCTGCAAACGGACTGTTGTTTGGTGGTAGGCTGGCTCGTGGCACTGGGGGCTGTCCAAATGGGTGCCCTGATGGGCCAAACCTTTGAGTAAATGGAGGGGCACCAGGAGAATTCATTACCGGACCCGGGGCCATCTCTCCCTCTAGGGGGCTGAACCCATGTTTGGTGAAATCCTTGGGGCCAAACCCCTCCTACCGAGTCCTTGCATCATTTGCCCAAGCAAGGGGGGCTGAAACCCCTTGACCCCTGGCCTTGAATAAAAAGGGGGCGCAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCATCGTTGGCTGCCAC