ORFeome > qrsl1 ORF1 – XORFeome v1.0

qrsl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: qrsl1
Gene ID: 5787983
Gene Page ID: 5787966
ORF Xenbase ID: 17291937

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042285
Original XGC clone length: 1575

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ824379
dbEST ID: 79642081
Trimmed Sequence: ATGCTGGGAATGAGTTTGCGGGAGGCAGCTGCTGTGCTGAGACTTGGACAAGTAAAACCTACTGAATTGTGCCAGAAGTGTCTTTCTTTGATCAAAGAAACATCATTCCTTAATGCCTACATAACTATAACTGAAGACATTGCCTTAAAGCAGGCAGCTGAAGCAGATAAAAGATTCGCCCAAGGCAAACCCTTGGGAGAATTAGACGGAATTCCTATAGCAATTAAGGACAACTTTAGCACAGCAGGAATAGAGACAACATGCGCATCACGAATGTTAAAAGGTTATGTTGCTCCATATAATGCTACAGTTGTTCAGAAATTATTTGATCAAGGAGCTGTGCTTATGGGAAAAACAAACCTGGATGAGTTTGGTATGGGATCTGGGAGCACTGATAGTATTTTTGGGCCAGTAAGAAATCCATGGAGCTATTCCAGATCTTACATAGAAAAGCGACCTATAAGTCACCATGCTGCCAAGGATGATTCTGATTGGGTCATAGCAGGTGGCAGCTCAGGAGGCAGCGCTTGTGCTGTGTCTGCTGGGACATGCTATTTAGCAATAGGCTCTGATACAGGAGGTTCCACTCGAAACCCTGCTTTCTCACTGTGGAGTTGTGGGCCTGAAACCTACCTACGGGGCTTGTGTCTCGTCATGGTCTAAATCCACTGGGGGATTCCATGGGAGATACCAGGGAATATAAACCAAAAATGGGGGAT
Full Trace Sequence: AGTCGATTTTTTATTTCGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGGAATGAGTTTGCGGGAGGCAGCTGCTGTGCTGAGACTTGGACAAGTAAAACCTACTGAATTGTGCCAGAAGTGTCTTTCTTTGATCAAAGAAACATCATTCCTTAATGCCTACATAACTATAACTGAAGACATTGCCTTAAAGCAGGCAGCTGAAGCAGATAAAAGATTCGCCCAAGGCAAACCCTTGGGAGAATTAGACGGAATTCCTATAGCAATTAAGGACAACTTTAGCACAGCAGGAATAGAGACAACATGCGCATCACGAATGTTAAAAGGTTATGTTGCTCCATATAATGCTACAGTTGTTCAGAAATTATTTGATCAAGGAGCTGTGCTTATGGGAAAAACAAACCTGGATGAGTTTGGTATGGGATCTGGGAGCACTGATAGTATTTTTGGGCCAGTAAGAAATCCATGGAGCTATTCCAGATCTTACATAGAAAAGCGACCTATAAGTCACCATGCTGCCAAGGATGATTCTGATTGGGTCATAGCAGGTGGCAGCTCAGGAGGCAGCGCTTGTGCTGTGTCTGCTGGGACATGCTATTTAGCAATAGGCTCTGATACAGGAGGTTCCACTCGAAACCCTGCTTTCTCACTGTGGAGTTGTGGGCCTGAAACCTACCTACGGGGCTTGTGTCTCGTCATGGTCTAAATCCACTGGGGGATTCCATGGGAGATACCAGGGAATATAAACCAAAAATGGGGGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGGAATGAGTTTGCGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829738
dbEST ID: 79647440
Trimmed Sequence: CACAAAGGAAGCAGATTTACTGTATTGCAGAACAATGCTCCCATTTCCCAAGTCTCTGTTAAACTGTAAAGGAGAGAAGTCCATTTGTTTTTCACACCATTTGGCCACTGTAAGGAGCTGCCGCTCACAGAAAGCACGGCCGATGAACTGAAGGCCAAGCGGCAATCCCCTACTAGAAAGGCCTGCAGGGACTGTTACAGCTGGGAGACCAGCCATGTTGGTACACTGAGTGAAGACATCTTCTTCAGCGCTGCGTGTTCTGTTGTCTTCCTGGATGAACTCTAAATAGGGTGCGGCATCTCCTAGCGTAGTTGGAGTTAGCAAAACATGGACGCCACTGTTAAAAACCTTGACAAAATCATCTGCTATGAGGCGCCGAACTTTCTGAGCCTTCACAAAATACTTTTCATAGTTCTGCTTTAAAAGAAAGTAGTTTCCAGACAATATTCTTCCTCTCACAACATCATTGAAGCCTTCTCTCCTGGTTGCTGCATACATTGCTTCCGTTGAGTCATCAATATCAGAGCGGTGCCCATATTCCAAGCCATCAAATCGAGCCATGTTAGAAGCCACCTCAGCTGTGCACAGGACATGATAACACACAATTGAATAGGGTGTATGTGGCAAAGAAACTTCCATGACCCTGGGCTCCCCGCTTTTTCAACAAAGTCTGCTGTCTTTGAACCAAAAGTGACAAGATTTTCTGTAAACCGAACCGGGGGGGCAGGGGAATTTCCCTTTAGGGATTGCCCCATTG
Full Trace Sequence: CCTGCCGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACAAAGGAAGCAGATTTACTGTATTGCAGAACAATGCTCCCATTTCCCAAGTCTCTGTTAAACTGTAAAGGAGAGAAGTCCATTTGTTTTTCACACCATTTGGCCACTGTAAGGAGCTGCCGCTCACAGAAAGCACGGCCGATGAACTGAAGGCCAAGCGGCAATCCCCTACTAGAAAGGCCTGCAGGGACTGTTACAGCTGGGAGACCAGCCATGTTGGTACACTGAGTGAAGACATCTTCTTCAGCGCTGCGTGTTCTGTTGTCTTCCTGGATGAACTCTAAATAGGGTGCGGCATCTCCTAGCGTAGTTGGAGTTAGCAAAACATGGACGCCACTGTTAAAAACCTTGACAAAATCATCTGCTATGAGGCGCCGAACTTTCTGAGCCTTCACAAAATACTTTTCATAGTTCTGCTTTAAAAGAAAGTAGTTTCCAGACAATATTCTTCCTCTCACAACATCATTGAAGCCTTCTCTCCTGGTTGCTGCATACATTGCTTCCGTTGAGTCATCAATATCAGAGCGGTGCCCATATTCCAAGCCATCAAATCGAGCCATGTTAGAAGCCACCTCAGCTGTGCACAGGACATGATAACACACAATTGAATAGGGTGTATGTGGCAAAGAAACTTCCATGACCCTGGGCTCCCCGCTTTTTCAACAAAGTCTGCTGTCTTTGAACCAAAAGTGACAAGATTTTCTGTAAACCGAACCGGGGGGGCAGGGGAATTTCCCTTTAGGGATTGCCCCATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAAAGGAAGCAGATTTACTGT