ORFeome > qtrt1 ORF1 – XORFeome v1.0

qtrt1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: qtrt1
Gene ID: 6076294
Gene Page ID: 6076184
ORF Xenbase ID: 17291955

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097803
Original XGC clone length: 1191

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ838406
dbEST ID: 79656108
Trimmed Sequence: ATGGCGGCGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCAGGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTTCCATAATCCAACGTGGTCTGGATGCTGAACTGCCCAAGCAATGTTTGCAGGAGATGACTTAAACGGAATGTCCCTGGCTTTGCTATTGGTTGGCCTTAACGGAAGAAGAAAAAAAAGAATCAT
Full Trace Sequence: GGGGGCCCATATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGACCAAGAGCCACGCTCTAGTACACCGGGTGTTAGCGGAATGCCCGGTGACCAAGGCGCGGGCGTGTGAGTTACAGATGCCCCATGGCCAGGTGAAGACTCCCGTGTTCATGCCCGTCGGGACGCAGGGAACCATGAAAGGGGTGACGGCGGATCAGCTGCGGAATCTGGGCTGTGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGAGGCCGGGTCCTGAGATCATGAAGAAGGCAAGTGGCCTCCACGGTTTTATGAACTGGGACAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGCTGTCAAAGGTGACGGAAGAAGGGGTGCAATTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAGAAATCCATTGAAATCCAAAATGCATTGGGCTCTGATATCATGATGCAACTAGATGATGTAGTGAGCAGCACAATCTCAGGCCCCCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCGGCCAACGGTAACCCCGATCGGCAGAATCTGTTTTCCATAATCCAACGTGGTCTGGATGCTGAACTGCCCAAGCAATGTTTGCAGGAGATGACTTAAACGGAATGTCCCTGGCTTTGCTATTGGTTGGCCTTAACGGAAGAAGAAAAAAAAGAATCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGACCAAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838405
dbEST ID: 79656107
Trimmed Sequence: CTGCAGGGTGATGCCGACTGTCTCCAGAGCAGCCACAGCCCATTGGGGATACTTGTCTTTGTTGCCATACATGGTTTTCATAAAGTCCTGCACAAACTGGGGGAAACGACCCTGCAGGATACTCTCCCTCACAGAGCGCATAAGGTTCAGCTGATAGGCAATGTTATGTATTGTAATGTGGTGCATAGCAGCAGTGTCACTTTTAAACAAGGCATTGATATAGGACCGGCTGTACCTTTGACAAGTGGGACAATCACAGTTCTTGTCTATGGGCTGGAAATCTTTAGCAAACTGTTTGCTCTTTAGCTGCAGGGAACCCCAGGGAACCAGCGCTGATCCGAACCTAGCTGTCCTTGTTGGGAAAACGCAGTCGAACATATCACAGCCCAGAGCTACACATACCACAAGGTCAGTAGCGTACCCCACTCCCATAAGGTAACGAGGTTTGTCCCGAGGCCAATGGTCAGTGCTGAGGGTCACCATCCTCCACAAATGATCTTTCTCTTCTCCTCCCCTCAGGCACCAATAGCAAAACCCGGGACATCGGCGTTAGTCATCTCCTGCCAACATTGCTTGCGCAGTTCCGCCTCCCGACCACCTTGGATTAGGGGAAAAAAAATTCTGCCGAACCGGGGTTACCGGTGGGCCACAATAACATCGATCCACCCCACCGGAAAGACCCGGTGCATGTCCTCCCTCCCCGCGGGGCGC
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCAGGGTGATGCCGACTGTCTCCAGAGCAGCCACAGCCCATTGGGGATACTTGTCTTTGTTGCCATACATGGTTTTCATAAAGTCCTGCACAAACTGGGGGAAACGACCCTGCAGGATACTCTCCCTCACAGAGCGCATAAGGTTCAGCTGATAGGCAATGTTATGTATTGTAATGTGGTGCATAGCAGCAGTGTCACTTTTAAACAAGGCATTGATATAGGACCGGCTGTACCTTTGACAAGTGGGACAATCACAGTTCTTGTCTATGGGCTGGAAATCTTTAGCAAACTGTTTGCTCTTTAGCTGCAGGGAACCCCAGGGAACCAGCGCTGATCCGAACCTAGCTGTCCTTGTTGGGAAAACGCAGTCGAACATATCACAGCCCAGAGCTACACATACCACAAGGTCAGTAGCGTACCCCACTCCCATAAGGTAACGAGGTTTGTCCCGAGGCCAATGGTCAGTGCTGAGGGTCACCATCCTCCACAAATGATCTTTCTCTTCTCCTCCCCTCAGGCACCAATAGCAAAACCCGGGACATCGGCGTTAGTCATCTCCTGCCAACATTGCTTGCGCAGTTCCGCCTCCCGACCACCTTGGATTAGGGGAAAAAAAATTCTGCCGAACCGGGGTTACCGGTGGGCCACAATAACATCGATCCACCCCACCGGAAAGACCCGGTGCATGTCCTCCCTCCCCGCGGGGCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCAGGGTGATGCCGA