ORFeome > rab24 ORF1 – XORFeome v1.0

rab24 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rab24
Gene ID: 866068
Gene Page ID: 491488
ORF Xenbase ID: 17292075

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078502
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ839722
dbEST ID: 79657424
Trimmed Sequence: ATGAGTGGGCAACGCGTGGACGTTAAAGTGGTGATGCTGGGAAAAGAATCCGTTGGGAAGACAAGCCTTGTGGAGAGATATGTGCACCACCGCTTCCTTCAAGGACCCTACCAGAATACCATTGGAGCTGCATTTGTTGCCAAAACTATGTATGTGGATGGGCGCAGTCTAACATTGGGAATATGGGACACTGCTGGCTCTGAACGTTATGAAGCCATGAGTCGCATCTATTACCGAGGGGCCAAAGCAGCTATAGTTTGTTATGATCTCACTGACGCCAGCAGTTTTGATCGAGTCAGATTCTGGGTGAATGAGCTGCAGAACTTTGAGGAGCACTGCCGGATTTACATTTGTGGTACCAAAAGTGACTTAATTGAAAATGATAAAAGCCTGCGTCAGGTGGACTTCCATGATGTTCAGGATTATGCCGAAGAGATAAAAGCTCAAGTCTGTGAGACATCTAGTAAAACTGGCCAGAGTGTCGATGAGCTTTTCCAGAAAGTAGCCGAGGACTGTGTGAACTTTAATTCTATGCATGGTCCAACAGAGGCAAAAGGTGTGGATCTGAATCAAAAGCGAAATTCCACGATGTACTCCTGCTGCCATCACTTGCCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGGGCAACGCGTGGACGTTAAAGTGGTGATGCTGGGAAAAGAATCCGTTGGGAAGACAAGCCTTGTGGAGAGATATGTGCACCACCGCTTCCTTCAAGGACCCTACCAGAATACCATTGGAGCTGCATTTGTTGCCAAAACTATGTATGTGGATGGGCGCAGTCTAACATTGGGAATATGGGACACTGCTGGCTCTGAACGTTATGAAGCCATGAGTCGCATCTATTACCGAGGGGCCAAAGCAGCTATAGTTTGTTATGATCTCACTGACGCCAGCAGTTTTGATCGAGTCAGATTCTGGGTGAATGAGCTGCAGAACTTTGAGGAGCACTGCCGGATTTACATTTGTGGTACCAAAAGTGACTTAATTGAAAATGATAAAAGCCTGCGTCAGGTGGACTTCCATGATGTTCAGGATTATGCCGAAGAGATAAAAGCTCAAGTCTGTGAGACATCTAGTAAAACTGGCCAGAGTGTCGATGAGCTTTTCCAGAAAGTAGCCGAGGACTGTGTGAACTTTAATTCTATGCATGGTCCAACAGAGGCAAAAGGTGTGGATCTGAATCAAAAGCGAAATTCCACGATGTACTCCTGCTGCCATCACTTGCCCAACTTTCTTGTACAAAGTTGGCATTTTAAGAAAGCCATTGCTTTACAATTTGTTGCAACGAAACAGGTCCCTATCAGTCCAAATTAAATCATTTATTTCCCATCCCGGCCTATTTCCCCCTATGTTGAGATTAAAAAAAAAAAGAAAAATAACTAATTTTCCTGGGCAGCCTCCGGGCCGGGTGTTCAAAAAAATTCTCTAGAAAATTTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGGGCAACGCGTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839721
dbEST ID: 79657423
Trimmed Sequence: GTGATGGCAGCAGGAGTACATCGTGGAATTTCGCTTTTGATTCAGATCCACACCTTTTGCCTCTGTTGGACCATGCATAGAATTAAAGTTCACACAGTCCTCGGCTACTTTCTGGAAAAGCTCATCGACACTCTGGCCAGTTTTACTAGATGTCTCACAGACTTGAGCTTTTATCTCTTCGGCATAATCCTGAACATCATGGAAGTCCACCTGACGCAGGCTTTTATCATTTTCAATTAAGTCACTTTTGGTACCACAAATGTAAATCCGGCAGTGCTCCTCAAAGTTCTGCAGCTCATTCACCCANAATCTGACTCGATCAAAACTGCTGGCGTCAGTGAGATCATAACAAACTATAGCTGCTTTGGCCCCTCGGTAATAGATGCGACTCATGGCTTCATAACGTTCAGAGCCGGCAGTGTCCCATATTCCCAATGTTAGACTGCGCCCATCCACATACATAGTTTTGGCAACAAATGCAGCTCCAATGGTATTCTGGTAGGGTCCTTGAAGGAAGCGGTGGTGCACATATCTCTCCACAAGGCTTGTCTTCCCAACGGATTCTTTTCCCAGCATCACCCCTTTAACGTCCACGCGTTTCCCGACTCATGGTGGCAACTTTGATAGTACCAAGTTGGCTTTTTAAAAAAGGCATGGCTCATCAATTTATTGCCACGAAACATGGTTCTCTATCAAAAAAAAAAAAAAAAAAAATAAATTTGAAGCCACAAGCTTAAAAAGATGCCTCGTCGTTTTACAAAGAAAAAACAAGGAACCTTGGTGG
Full Trace Sequence: AACGTCTATTGACCATTGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGATGGCAGCAGGAGTACATCGTGGAATTTCGCTTTTGATTCAGATCCACACCTTTTGCCTCTGTTGGACCATGCATAGAATTAAAGTTCACACAGTCCTCGGCTACTTTCTGGAAAAGCTCATCGACACTCTGGCCAGTTTTACTAGATGTCTCACAGACTTGAGCTTTTATCTCTTCGGCATAATCCTGAACATCATGGAAGTCCACCTGACGCAGGCTTTTATCATTTTCAATTAAGTCACTTTTGGTACCACAAATGTAAATCCGGCAGTGCTCCTCAAAGTTCTGCAGCTCATTCACCCANAATCTGACTCGATCAAAACTGCTGGCGTCAGTGAGATCATAACAAACTATAGCTGCTTTGGCCCCTCGGTAATAGATGCGACTCATGGCTTCATAACGTTCAGAGCCGGCAGTGTCCCATATTCCCAATGTTAGACTGCGCCCATCCACATACATAGTTTTGGCAACAAATGCAGCTCCAATGGTATTCTGGTAGGGTCCTTGAAGGAAGCGGTGGTGCACATATCTCTCCACAAGGCTTGTCTTCCCAACGGATTCTTTTCCCAGCATCACCCCTTTAACGTCCACGCGTTTCCCGACTCATGGTGGCAACTTTGATAGTACCAAGTTGGCTTTTTAAAAAAGGCATGGCTCATCAATTTATTGCCACGAAACATGGTTCTCTATCAAAAAAAAAAAAAAAAAAAATAAATTTGAAGCCACAAGCTTAAAAAGATGCCTCGTCGTTTTACAAAGAAAAAACAAGGAACCTTGGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGATGGCAGCAGGAGT