ORFeome > rab3d ORF2 – XORFeome v1.0

rab3d ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rab3d
Gene ID: 6254202
Gene Page ID: 490390
ORF Xenbase ID: 17292177

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106308
Original XGC clone length: 654

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ837955
dbEST ID: 79655657
Trimmed Sequence: ATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAATCTGCCCCCAAAAACAAAACAACGGCTCCTGTTGGCCAACTTTCTTGGACAAGGTTTGCATTATAGAAAACATTGCTAAATAAATTTGTTGCCACGAAGAAGGTTCAGAACAAGTCAAAATAAAAATCCTTAATTTTGCCAACCCAGCGTAATATAAAAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: TCGGGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAATCTGCCCCCAAAAACAAAACAACGGCTCCTGTTGGCCAACTTTCTTGGACAAGGTTTGCATTATAGAAAACATTGCTAAATAAATTTGTTGCCACGAAGAAGGTTCAGAACAAGTCAAAATAAAAATCCTTAATTTTGCCAACCCAGCGTAATATAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCTGCCAGCGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837954
dbEST ID: 79655656
Trimmed Sequence: ACAGGAGCAGTTGCTGTTGTCTTTGGGGGCAGACTCAGTGAGCTGGGCAGTGCCACTCCCTGGGACAGGTCCATTCTCCAGGCTCTCGTTCATCTTCTCACAGATGATGTCCACTAAACGTTCAAATACTTGCTTCACATTGATGTTGTCTTTAGCGCTGGCCTCGAAAAACTCAAATCCTAGTTCCTCAGCAAGTTTCCGCCCATCCTCAGCAGCGATCACTCGATCATCTTCGAGGTCACACTTGTTTCCTACTAACAGAACCTGCGCATTGTCCCAGGAATATGTCTTAATTTGGGTTGCCCAGTCCTGCACAGCATTGAAGGATTCCAGGTTTGAGATGTCATACATGAGCAAGAAACCCATGGCGCCACGGTAATATGCTGTTGTGATTGTGCGGTACCTCTCTTGACCAGCTGTGTCCCAGATCTGCAACTTGACCCTCTTTTCGTTCCTGTACACCGTCTTGACCTTGAAGTCGATCCCCACTGTACTGACCAAAACCGAATTGAAGGAATCGTCTGCATATCGGAAAAGGAAAGAGGTTTTTCCTACCCTGCTGTTGCCGATGAACCGGAGTTTGAACATGTAGTCAAAGCTTTGGTCACCAACATCTTTTTGGGGCTGGGGGGGGTCGGCTGGCAAGGCCCTGGTGCCCAGCTTTTTTGTACAAGGTTGGCATTAGAAAAAAAGGCAGTGCGGCGTCAATTTTTTTGGAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAA
Full Trace Sequence: AAAACAGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGGAGCAGTTGCTGTTGTCTTTGGGGGCAGACTCAGTGAGCTGGGCAGTGCCACTCCCTGGGACAGGTCCATTCTCCAGGCTCTCGTTCATCTTCTCACAGATGATGTCCACTAAACGTTCAAATACTTGCTTCACATTGATGTTGTCTTTAGCGCTGGCCTCGAAAAACTCAAATCCTAGTTCCTCAGCAAGTTTCCGCCCATCCTCAGCAGCGATCACTCGATCATCTTCGAGGTCACACTTGTTTCCTACTAACAGAACCTGCGCATTGTCCCAGGAATATGTCTTAATTTGGGTTGCCCAGTCCTGCACAGCATTGAAGGATTCCAGGTTTGAGATGTCATACATGAGCAAGAAACCCATGGCGCCACGGTAATATGCTGTTGTGATTGTGCGGTACCTCTCTTGACCAGCTGTGTCCCAGATCTGCAACTTGACCCTCTTTTCGTTCCTGTACACCGTCTTGACCTTGAAGTCGATCCCCACTGTACTGACCAAAACCGAATTGAAGGAATCGTCTGCATATCGGAAAAGGAAAGAGGTTTTTCCTACCCTGCTGTTGCCGATGAACCGGAGTTTGAACATGTAGTCAAAGCTTTGGTCACCAACATCTTTTTGGGGCTGGGGGGGGTCGGCTGGCAAGGCCCTGGTGCCCAGCTTTTTTGTACAAGGTTGGCATTAGAAAAAAAGGCAGTGCGGCGTCAATTTTTTTGGAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGGAGCAGTTGCTGTT