ORFeome > rab3ip ORF1 – XORFeome v1.0

rab3ip ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rab3ip
Gene ID: 978878
Gene Page ID: 978870
ORF Xenbase ID: 17292189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054310
Original XGC clone length: 1365

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ839499
dbEST ID: 79657201
Trimmed Sequence: ATGGCTAGCGACCCTCTGGAAGGCTTTCATGAAGTGAATCTTGCTTCACCTACCACTCCAGATCTGGGTGTGAGTGATGTCAAAGTTCAGGAACCAACTACCTCTCCGAATCCTATCTATCGGCCCCATTTAACTGTTAGCTCCAGCCCTATACAGCCCAACAGTTTGAATGCTGCTGACCTTCCAACTCAGCCAGTGTACTCTTCTCCAAGGCATTTAAACTGTGGAAACACTACAGGCATAAGCCCCAATGTACAAGAATCTATATCCTGCTCTACCTCTGGATGCCCAACATGTTCTCTCAAATACAGCAGAAAGAAGGACAACCGTGCAGAGAGAGAGTTTTTGCAAGGCGCCACATTGACAGATGTAGTGGATGGCTCACATGATGTGCTTGGTTGCAGCACAGACAGCTTGTCAAGATTACGGAGCCCTTCTGTCCAGGAAGTTAGAGACCGAGGCTATGAACGGTTACGAGAAGAGCTGGCTAAAGCTAAACGGGACCTAAAACTTAAAGATGAAGAATGTGAAAGACTTTCTAAAGTACGGGACCAGCTGGGACAGGAACTGGAGGAGCTGACAGCAAGTCTTTTTGAAGAAGCACATAAAATGGTCCGGGAAGCAAACCTGAAACAGGCCGCTGCAGAAAAACAGCTTAAGGAGGCACAGGGAAAGATTGATGTGCTGCAGGCTAAGGTAACAGCTTTTAAAACACTGGTTCTCTCCACCTCCCCAACTTCTCCCACAAAAAAACTGCAACCCTGGTTAGGCCACCCTTTTAAAAAGGGGCCCCTGGCCA
Full Trace Sequence: CGCGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAGCGACCCTCTGGAAGGCTTTCATGAAGTGAATCTTGCTTCACCTACCACTCCAGATCTGGGTGTGAGTGATGTCAAAGTTCAGGAACCAACTACCTCTCCGAATCCTATCTATCGGCCCCATTTAACTGTTAGCTCCAGCCCTATACAGCCCAACAGTTTGAATGCTGCTGACCTTCCAACTCAGCCAGTGTACTCTTCTCCAAGGCATTTAAACTGTGGAAACACTACAGGCATAAGCCCCAATGTACAAGAATCTATATCCTGCTCTACCTCTGGATGCCCAACATGTTCTCTCAAATACAGCAGAAAGAAGGACAACCGTGCAGAGAGAGAGTTTTTGCAAGGCGCCACATTGACAGATGTAGTGGATGGCTCACATGATGTGCTTGGTTGCAGCACAGACAGCTTGTCAAGATTACGGAGCCCTTCTGTCCAGGAAGTTAGAGACCGAGGCTATGAACGGTTACGAGAAGAGCTGGCTAAAGCTAAACGGGACCTAAAACTTAAAGATGAAGAATGTGAAAGACTTTCTAAAGTACGGGACCAGCTGGGACAGGAACTGGAGGAGCTGACAGCAAGTCTTTTTGAAGAAGCACATAAAATGGTCCGGGAAGCAAACCTGAAACAGGCCGCTGCAGAAAAACAGCTTAAGGAGGCACAGGGAAAGATTGATGTGCTGCAGGCTAAGGTAACAGCTTTTAAAACACTGGTTCTCTCCACCTCCCCAACTTCTCCCACAAAAAAACTGCAACCCTGGTTAGGCCACCCTTTTAAAAAGGGGCCCCTGGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAGCGACCCTCTGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839498
dbEST ID: 79657200
Trimmed Sequence: CTCTTTGAAATATCCAAGTTTTGCTTGAGACATTTCTTTCCTAAGTTGCATGACCTCCCAAAACATCTGATCAACATCCTGCTGTTTTAGAAGTCCTTGATGGATGTACCGGATATATGTAAAGAAATTGCACACAGATGCAATCCTATATCTACAGCAAGGAGAAATATAATAGTAATTGCTGGAGTCTCCCAGTTTAATTCTGTGCTTACACAACTTTGTCTGACCACTTAACGCGCATTTCTTTGATCCTCCACATTCAACAGCTGATGCTTTAACAAAGCGCACAGATTGCTGACCAGCAGGCTCAATGCTTAAGGTGTTGTTTTCTACTGCTTCAAGAACCGCTGCCGCCAGCTCACTTTTAGGGAATGTTAAACAAGGGCAGATATCCTCCTGATATATTCTGTGCAAAAATGGGCATGTCCTGTTCATGGAAGGCTCTTCTTTCCAAGTCCTGAATTCATAGTAAAGCGATAAATCAGGCTCTTTCGATTCTGTGACAATTGGTGGTAGTACACTGAGGTCTAGTGTTCCTCCACCCATAGCACTGCTTGTGCTTTTGTTCCTGGCATGGCCCTTCTTAAAGGGTGCCTTACCCGGTTGCAAGTCTTTTGTGGGAGATGTTTGGTGAGGTTGAGAAAAACAATGGTTTTCAAAGCTGCTACCTCCGCCCGGCAGCCAATTAATTCTTTCCCTGTGGCCCCCCTAAACTGGTTTTTTCGCCAGCGGCCCTGGTTTTCAGGTTTTGGCTTTCCCCGGAAACATTTTTTAAGT
Full Trace Sequence: GGTAAAANGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTTGAAATATCCAAGTTTTGCTTGAGACATTTCTTTCCTAAGTTGCATGACCTCCCAAAACATCTGATCAACATCCTGCTGTTTTAGAAGTCCTTGATGGATGTACCGGATATATGTAAAGAAATTGCACACAGATGCAATCCTATATCTACAGCAAGGAGAAATATAATAGTAATTGCTGGAGTCTCCCAGTTTAATTCTGTGCTTACACAACTTTGTCTGACCACTTAACGCGCATTTCTTTGATCCTCCACATTCAACAGCTGATGCTTTAACAAAGCGCACAGATTGCTGACCAGCAGGCTCAATGCTTAAGGTGTTGTTTTCTACTGCTTCAAGAACCGCTGCCGCCAGCTCACTTTTAGGGAATGTTAAACAAGGGCAGATATCCTCCTGATATATTCTGTGCAAAAATGGGCATGTCCTGTTCATGGAAGGCTCTTCTTTCCAAGTCCTGAATTCATAGTAAAGCGATAAATCAGGCTCTTTCGATTCTGTGACAATTGGTGGTAGTACACTGAGGTCTAGTGTTCCTCCACCCATAGCACTGCTTGTGCTTTTGTTCCTGGCATGGCCCTTCTTAAAGGGTGCCTTACCCGGTTGCAAGTCTTTTGTGGGAGATGTTTGGTGAGGTTGAGAAAAACAATGGTTTTCAAAGCTGCTACCTCCGCCCGGCAGCCAATTAATTCTTTCCCTGTGGCCCCCCTAAACTGGTTTTTTCGCCAGCGGCCCTGGTTTTCAGGTTTTGGCTTTCCCCGGAAACATTTTTTAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTTGAAATATCCAAGTTTTGC